Regulon of IdeR in Clostridium nexile DSM 1787

Properties
Regulator type:	Transcription factor
TF locus tag:	CLONEX_01968
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	15
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 4.9 Sequence: ATGGTTAGTTAAAACTAATAAA Locus tag: CLONEX_01965 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: CLONEX_01964 Name: null Funciton: hypothetical protein Locus tag: CLONEX_01963 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family Locus tag: CLONEX_01962 Name: null Funciton: hypothetical protein Locus tag: CLONEX_01961 Name: COG2217 Funciton: Cation transporting ATPase
	CLONEX_01965	feoB	Ferrous iron transport protein B
	CLONEX_01964		hypothetical protein
	CLONEX_01963	fur	Transcriptional regulator for iron transport and metabolism, Fur family
	CLONEX_01962		hypothetical protein
	CLONEX_01961	COG2217	Cation transporting ATPase
Position: -65 Score: 6.5 Sequence: AACGTTAGAGTATACTAACCAT Locus tag: CLONEX_01967 Name: null Funciton: hypothetical protein Locus tag: CLONEX_01966 Name: feoA Funciton: Ferrous iron transport protein A
	CLONEX_01967		hypothetical protein
	CLONEX_01966	feoA	Ferrous iron transport protein A
Position: -63 Score: 5.1 Sequence: CTGGTTAGTTTAATCTAACAAA Locus tag: CLONEX_02589 Name: PF05031 Funciton: Iron transport-associated domain Locus tag: CLONEX_02590 Name: PF11545 Funciton: Cell surface heme-binding protein Shp Locus tag: CLONEX_02591 Name: COG0614 Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: CLONEX_02592 Name: COG0609 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: CLONEX_02593 Name: COG1120 Funciton: ABC-type Fe3+-siderophores transport systems, ATPase components
	CLONEX_02589	PF05031	Iron transport-associated domain
	CLONEX_02590	PF11545	Cell surface heme-binding protein Shp
	CLONEX_02591	COG0614	ABC-type Fe3+-hydroxamate transport system, periplasmic component
	CLONEX_02592	COG0609	ABC-type Fe3+-siderophore transport system, permease component
	CLONEX_02593	COG1120	ABC-type Fe3+-siderophores transport systems, ATPase components
Position: -32 Score: 4.9 Sequence: TAAGTTAGAAATAACTAACTCA Locus tag: CLONEX_01942 Name: null Funciton: hypothetical protein Locus tag: CLONEX_01941 Name: COG0716 Funciton: Flavodoxins
	CLONEX_01942		hypothetical protein
	CLONEX_01941	COG0716	Flavodoxins
Position: -139 Score: 6 Sequence: ATGGTTAGTATACTCTAACGTT Locus tag: CLONEX_01968 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	CLONEX_01968	ideR	Predicted iron-dependent repressor, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of IdeR in Clostridium nexile DSM 1787

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --