Regulon of IdeR in Roseburia intestinalis L1-82

Properties
Regulator type:	Transcription factor
TF locus tag:	ROSINTL182_00530
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5 Sequence: GGCGTTAGCAAATGCTAACAAA Locus tag: ROSINTL182_04347 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: ROSINTL182_04346 Name: null Funciton: hypothetical protein Locus tag: ROSINTL182_04345 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family
	ROSINTL182_04347	feoB	Ferrous iron transport protein B
	ROSINTL182_04346		hypothetical protein
	ROSINTL182_04345	fur	Transcriptional regulator for iron transport and metabolism, Fur family
Position: -71 Score: 6.7 Sequence: AACGTTAGAATATACTAACCAA Locus tag: ROSINTL182_04350 Name: null Funciton: hypothetical protein Locus tag: ROSINTL182_04349 Name: feoA Funciton: Ferrous iron transport protein A
	ROSINTL182_04350		hypothetical protein
	ROSINTL182_04349	feoA	Ferrous iron transport protein A
Position: -55 Score: 5.4 Sequence: ATAGTTAGACAAAACTAACAAT Locus tag: ROSINTL182_03016 Name: eno Funciton: Enolase (EC 4.2.1.11)
	ROSINTL182_03016	eno	Enolase (EC 4.2.1.11)
Position: -133 Score: 4.5 Sequence: TACAAAAGCATATTCTATCATT Position: -89 Score: 6.2 Sequence: AAAGTTAGTGTAATCTAACTAT Position: -24 Score: 5.4 Sequence: GGAGTTAGGATAAACTAACTAT Locus tag: ROSINTL182_04597 Name: null Funciton: hypothetical protein Locus tag: ROSINTL182_04596 Name: COG0716 Funciton: Flavodoxins
	ROSINTL182_04597		hypothetical protein
	ROSINTL182_04596	COG0716	Flavodoxins

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD