Regulog Fur - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - FUR
- By TF family - FUR
- By effector - Iron ion, (Fe2+)
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 5 | 3 |
| Psychromonas sp. CNPT3 | 23 | 8 |
| Moritella sp. PE36 | 58 | 23 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 54 | 24 |
| Aeromonas salmonicida subsp. salmonicida A449 | 55 | 24 |
| Tolumonas auensis DSM 9187 | 21 | 8 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| PE36_02327 |
|
|
*
Moritella sp. PE36 Site: position = -94 score = 6.17115 sequence = TAATGAAAATTGTTATCATTT Gene: PE36_02327: Ferric siderophore receptor-like protein, TonB-dependent |
|
|
|
Ferric siderophore receptor-like protein, TonB-dependent |
| fecF |
|
*
Psychromonas sp. CNPT3 Site: position = -85 score = 5.11997 sequence = TAGTGATTATTGTTATCATTT Site: position = -91 score = 4.86819 sequence = AAATGATAGTGATTATTGTTA Gene: PCNPT3_08705: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein |
Gene: PE36_02322: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein |
|
|
|
Iron(III) dicitrate transport system periplasmic substrate-binding transport protein |
| fecD |
|
Gene: PCNPT3_08710: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
Gene: PE36_02317: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
|
|
|
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
| fecE |
|
Gene: PCNPT3_08715: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
Gene: PE36_02312: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
|
|
|
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| PE36_02307 |
|
|
Gene: PE36_02307: TonB system biopolymer transport component; Chromosome segregation ATPase |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -59 score = 5.39528 sequence = CAATGAGAATAGTTATCATTG Gene: AHA_4252: TonB system biopolymer transport component; Chromosome segregation ATPase |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -35 score = 5.39528 sequence = CAATGAGAATAGTTATCATTG Gene: ASA_4323: TonB system biopolymer transport component; Chromosome segregation ATPase |
|
TonB system biopolymer transport component; Chromosome segregation ATPase |
| AHA_4251 |
|
|
Gene: PE36_02302: TonB system biopolymer transport component |
Gene: AHA_4251: TonB system biopolymer transport component |
Gene: ASA_4322: TonB system biopolymer transport component |
|
TonB system biopolymer transport component |
| exbB2 |
|
|
Gene: PE36_02297: Ferric siderophore transport system, biopolymer transport protein ExbB |
Gene: AHA_4250: Ferric siderophore transport system, biopolymer transport protein ExbB |
Gene: ASA_4321: Ferric siderophore transport system, biopolymer transport protein ExbB |
|
Ferric siderophore transport system, biopolymer transport protein ExbB |
| exbD2 |
|
|
Gene: PE36_02292: Ferric siderophore transport system, biopolymer transport protein ExbD |
Gene: AHA_4249: Ferric siderophore transport system, biopolymer transport protein ExbD |
Gene: ASA_4320: Ferric siderophore transport system, biopolymer transport protein ExbD |
|
Ferric siderophore transport system, biopolymer transport protein ExbD |
| tonB2 |
|
|
Gene: PE36_02287: Ferric siderophore transport system, periplasmic binding protein TonB |
Gene: AHA_4248: Ferric siderophore transport system, periplasmic binding protein TonB |
Gene: ASA_4319: Ferric siderophore transport system, periplasmic binding protein TonB |
|
Ferric siderophore transport system, periplasmic binding protein TonB |
| PE36_02282 |
|
|
Gene: PE36_02282: TPR domain protein, putative component of TonB system |
Gene: AHA_4247: TPR domain protein, putative component of TonB system |
Gene: ASA_4318: TPR domain protein, putative component of TonB system |
|
TPR domain protein, putative component of TonB system |
| CRON 2. | |||||||
| fbpA |
*
Psychromonas ingrahamii 37 Site: position = -32 score = 4.50541 sequence = TATCGTGAATTATTACCATTT Site: position = -56 score = 5.23317 sequence = TAATGATTATCATTATTATTA Site: position = -62 score = 5.89577 sequence = AAATGGTAATGATTATCATTA Gene: Ping_3007: Ferric iron ABC transporter, iron-binding protein |
*2
Psychromonas sp. CNPT3 Site: position = -32 score = 5.17198 sequence = AATTGATAATCATTATTACCA Gene: PCNPT3_11948: Ferric iron ABC transporter, iron-binding protein Gene: PCNPT3_11943: Ferric iron ABC transporter, iron-binding protein |
*
Moritella sp. PE36 Site: position = -102 score = 5.97095 sequence = TTATGAGAATTATTATCATTT Gene: PE36_07672: Ferric iron ABC transporter, iron-binding protein |
Gene: AHA_0650: Ferric iron ABC transporter, iron-binding protein |
Gene: ASA_0650: Ferric iron ABC transporter, iron-binding protein |
*
Tolumonas auensis DSM 9187 Site: position = -37 score = 5.80183 sequence = TTATGATAATGATTCTCATTA Site: position = -60 score = 5.46643 sequence = AAATGATATCCGTTCTCATAT Site: position = -87 score = 5.60668 sequence = AAACGATATTTATTTTCATTT Gene: Tola_2559: Ferric iron ABC transporter, iron-binding protein |
Ferric iron ABC transporter, iron-binding protein |
| fbpB |
Gene: Ping_3006: Ferric iron ABC transporter, permease protein |
Gene: PCNPT3_11938: Ferric iron ABC transporter, permease protein |
Gene: PE36_07667: Ferric iron ABC transporter, permease protein |
Gene: AHA_0651: Ferric iron ABC transporter, permease protein |
Gene: ASA_0651: Ferric iron ABC transporter, permease protein |
Gene: Tola_2558: Ferric iron ABC transporter, permease protein |
Ferric iron ABC transporter, permease protein |
| fbpC |
Gene: Ping_3005: Ferric iron ABC transporter, ATP-binding protein |
Gene: PCNPT3_11933: Ferric iron ABC transporter, ATP-binding protein |
Gene: PE36_07662: Ferric iron ABC transporter, ATP-binding protein |
Gene: AHA_0652: Ferric iron ABC transporter, ATP-binding protein |
Gene: ASA_0652: Ferric iron ABC transporter, ATP-binding protein |
Gene: Tola_2557: Ferric iron ABC transporter, ATP-binding protein |
Ferric iron ABC transporter, ATP-binding protein |
| CRON 3. | |||||||
| PCNPT3_11763 |
|
*
Psychromonas sp. CNPT3 Site: position = -111 score = 5.39171 sequence = GAATGAGAACTATTCTCGTTT Site: position = -156 score = 4.97742 sequence = TATTGATAATGACTTTCATTG Gene: PCNPT3_11763: hypothetical protein |
*
Moritella sp. PE36 Site: position = -58 score = 5.3559 sequence = TAATACGAACCATTCTCATTA Gene: PE36_14199: hypothetical protein |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -71 score = 5.12272 sequence = TAATGCACACCATTCTCATTT Gene: AHA_2481: hypothetical protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -71 score = 5.12272 sequence = TAATGCACACCATTCTCATTT Gene: ASA_1836: hypothetical protein |
|
hypothetical protein |
| PCNPT3_11758 |
|
Gene: PCNPT3_11758: hypothetical protein |
Gene: PE36_14204: hypothetical protein |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -80 score = 5.54753 sequence = AATTGATAACTCTTTTCATTA Gene: AHA_2544: hypothetical protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -80 score = 5.54753 sequence = AATTGATAACTCTTTTCATTA Gene: ASA_2551: hypothetical protein |
|
hypothetical protein |
| PCNPT3_11733 |
|
Gene: PCNPT3_11733: hypothetical protein |
*
Moritella sp. PE36 Site: position = -58 score = 5.26067 sequence = TAATGATAACCATTCTTAATC Gene: PE36_14229: hypothetical protein |
|
|
|
hypothetical protein |
| CRON 4. | |||||||
| COG3205 |
*
Psychromonas ingrahamii 37 Site: position = -57 score = 6.20462 sequence = AAATGATAACAGTTATCATTT Gene: Ping_0309: Predicted membrane protein |
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -70 score = 6.07702 sequence = AGATGAGAATAGTTTTCATTT Gene: AHA_3578: Predicted membrane protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -70 score = 6.07702 sequence = AGATGAGAATAGTTTTCATTT Gene: ASA_3536: Predicted membrane protein |
|
Predicted membrane protein |
| CRON 5. | |||||||
| fhuA |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -134 score = 5.28778 sequence = AGATGCAAATGATTAGCAATT Gene: AHA_4275: Ferric hydroxamate outer membrane receptor FhuA |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -155 score = 5.28778 sequence = AGATGCAAATGATTAGCAATT Gene: ASA_4363: Ferric hydroxamate outer membrane receptor FhuA |
|
Ferric hydroxamate outer membrane receptor FhuA |
| fhuB |
|
|
*
Moritella sp. PE36 Site: position = -2 score = 4.7848 sequence = TAATGAAAATTAAATTGATTT Site: position = -103 score = 4.86189 sequence = AAATGAGAATGATTAATGTTA Gene: PE36_19080: ABC transporter ATP-binding protein YojI |
Gene: AHA_4276: ABC transporter ATP-binding protein YojI |
Gene: ASA_4364: ABC transporter ATP-binding protein YojI |
*
Tolumonas auensis DSM 9187 Site: position = -38 score = 5.0959 sequence = TAATGGGAATAGTTATCAGTA Gene: Tola_1489: ABC transporter ATP-binding protein YojI |
ABC transporter ATP-binding protein YojI |
| fhuC |
|
|
|
Gene: AHA_4277: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC |
Gene: ASA_4365: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC |
*
Tolumonas auensis DSM 9187 Site: position = -60 score = 5.90495 sequence = AATTGATAACAATTATCATCT Gene: Tola_1485: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC |
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC |
| fhuD |
|
|
|
Gene: AHA_4278: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD |
Gene: ASA_4366: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD |
Gene: Tola_1486: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD |
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD |
| fhuE |
|
|
|
Gene: AHA_4279: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
Gene: ASA_4367: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
Gene: Tola_1487: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
| CRON 6. | |||||||
| hutX |
|
|
*
Moritella sp. PE36 Site: position = -86 score = 5.15592 sequence = AAATGAGAATTGGTTGCATTA Gene: PE36_06592: Putative heme iron utilization protein |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -97 score = 5.0469 sequence = GAATGAAAGCGATTATCAATT Gene: AHA_0967: Putative heme iron utilization protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -97 score = 5.0469 sequence = GAATGAAAGCGATTATCAATT Gene: ASA_3333: Putative heme iron utilization protein |
|
Putative heme iron utilization protein |
| hutZ |
|
|
Gene: PE36_06597: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: AHA_0968: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: ASA_3332: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
|
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
| CRON 7. | |||||||
| hutB |
|
|
*
Moritella sp. PE36 Site: position = -150 score = 5.15592 sequence = TAATGCAACCAATTCTCATTT Gene: PE36_06587: Hemin ABC transport system, periplasmic component |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -92 score = 5.0469 sequence = AATTGATAATCGCTTTCATTC Gene: AHA_0966: Hemin ABC transport system, periplasmic component |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -92 score = 5.0469 sequence = AATTGATAATCGCTTTCATTC Gene: ASA_3334: Hemin ABC transport system, periplasmic component |
|
Hemin ABC transport system, periplasmic component |
| hutC |
|
|
Gene: PE36_06582: Hemin ABC transporter, permease protein |
Gene: AHA_0965: Hemin ABC transporter, permease protein |
Gene: ASA_3335: Hemin ABC transporter, permease protein |
|
Hemin ABC transporter, permease protein |
| hutD |
|
|
Gene: PE36_06577: Hemin ABC transporter, ATP-binding protein |
Gene: AHA_0964: Hemin ABC transporter, ATP-binding protein |
Gene: ASA_3336: Hemin ABC transporter, ATP-binding protein |
|
Hemin ABC transporter, ATP-binding protein |
| CRON 8. | |||||||
| sitA |
|
*
Psychromonas sp. CNPT3 Site: position = -74 score = 5.13317 sequence = TAATGATTATCGTTTGCATTT Site: position = -80 score = 5.19087 sequence = TCATGATAATGATTATCGTTT Gene: PCNPT3_07645: Manganese ABC transporter, periplasmic-binding protein SitA |
*
Moritella sp. PE36 Site: position = -85 score = 6.34949 sequence = TAATGATAATAATTCTCATTT Gene: PE36_17360: Manganese ABC transporter, periplasmic-binding protein SitA |
|
|
|
Manganese ABC transporter, periplasmic-binding protein SitA |
| sitB |
|
Gene: PCNPT3_07650: Manganese ABC transporter, ATP-binding protein SitB |
Gene: PE36_17355: Manganese ABC transporter, ATP-binding protein SitB |
|
|
|
Manganese ABC transporter, ATP-binding protein SitB |
| sitC |
|
Gene: PCNPT3_07655: Manganese ABC transporter, inner membrane permease protein SitC |
Gene: PE36_17350: Manganese ABC transporter, inner membrane permease protein SitC |
|
|
|
Manganese ABC transporter, inner membrane permease protein SitC |
| sitD |
|
Gene: PCNPT3_07660: Manganese ABC transporter, inner membrane permease protein SitD |
Gene: PE36_17345: Manganese ABC transporter, inner membrane permease protein SitD |
|
|
|
Manganese ABC transporter, inner membrane permease protein SitD |
| CRON 9. | |||||||
| mntH |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -46 score = 6.29928 sequence = AATTGATAATAATTATCATTT Gene: AHA_0709: Manganese transport protein MntH |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -61 score = 6.14395 sequence = AATTGATAACAATTATCATTT Gene: ASA_0706: Manganese transport protein MntH |
|
Manganese transport protein MntH |
| CRON 10. | |||||||
| entC |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -44 score = 6.00891 sequence = AACTGATAATCATTATCATTT Gene: AHA_2479: Isochorismate synthase (EC 5.4.4.2) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -119 score = 6.28548 sequence = AATTGATAATCATTATCATTT Gene: ASA_1838: Isochorismate synthase (EC 5.4.4.2) |
|
Isochorismate synthase (EC 5.4.4.2) |
| entE |
|
|
|
Gene: AHA_2478: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) |
Gene: ASA_1839: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) |
|
2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) |
| entB |
|
|
|
Gene: AHA_2477: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis |
Gene: ASA_1840: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis |
|
Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis |
| entF |
|
|
|
Gene: AHA_2476: Enterobactin synthetase component F (EC 2.7.7.-) |
Gene: ASA_1841: Enterobactin synthetase component F (EC 2.7.7.-) |
|
Enterobactin synthetase component F (EC 2.7.7.-) |
| entA |
|
|
|
Gene: AHA_2475: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) |
Gene: ASA_1842: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) |
|
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) |
| CRON 11. | |||||||
| AHA_2992 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -60 score = 6.26581 sequence = AATTGATAATAATTTTCATTT Gene: AHA_2992: iron-chelator utilization protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -60 score = 6.11048 sequence = AATTGATAATAGTTTTCATTT Gene: ASA_3006: iron-chelator utilization protein |
|
iron-chelator utilization protein |
| CRON 12. | |||||||
| AHA_0514 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -90 score = 6.21918 sequence = AAATAATAATTATTATCATTT Gene: AHA_0514: FOG: TPR repeat |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -35 score = 6.21918 sequence = AAATAATAATTATTATCATTT Gene: ASA_3720: FOG: TPR repeat |
|
FOG: TPR repeat |
| sodA |
|
|
|
Gene: AHA_0515: Manganese superoxide dismutase (EC 1.15.1.1) |
Gene: ASA_3721: Manganese superoxide dismutase (EC 1.15.1.1) |
|
Manganese superoxide dismutase (EC 1.15.1.1) |
| CRON 13. | |||||||
| AHA_1970 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = 109 score = 5.72154 sequence = AAATAAAAATGATTACCATTT Gene: AHA_1970: hypothetical protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -80 score = 5.72154 sequence = AAATAAAAATGATTACCATTT Gene: ASA_1851: hypothetical protein |
|
hypothetical protein |
| fstC |
|
|
|
Gene: AHA_1969: Colicin I receptor precursor |
Gene: ASA_1850: Colicin I receptor precursor |
|
Colicin I receptor precursor |
| AHA_1968 |
|
|
|
Gene: AHA_1968: ABC-type Fe3+-siderophore transport system, permease component |
Gene: ASA_1849: ABC-type Fe3+-siderophore transport system, permease component |
|
ABC-type Fe3+-siderophore transport system, permease component |
| AHA_1967 |
|
|
|
Gene: AHA_1967: ABC-type Fe3+-siderophore transport system, permease component |
Gene: ASA_1848: ABC-type Fe3+-siderophore transport system, permease component |
|
ABC-type Fe3+-siderophore transport system, permease component |
| fecE |
|
|
|
Gene: AHA_1966: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
Gene: ASA_1847: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
|
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| CRON 14. | |||||||
| hutR |
|
|
|
*2
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -90 score = 4.70578 sequence = AAATGAGAATGATTCCGTTTA Site: position = -31 score = 4.82069 sequence = GTTTGATAACAGTTCTCAATA Gene: AHA_0972: TonB-dependent heme receptor HutR Site: position = -88 score = 5.87786 sequence = AAATGATAATGATTATCAATC Site: position = -20 score = 5.83741 sequence = AAATAATAATTATTCTCAATA Gene: AHA_1663: TonB-dependent heme receptor HutR |
*2
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -47 score = 5.14653 sequence = AAATAACAATCATTCTCAAAA Site: position = -115 score = 5.87786 sequence = AAATGATAATGATTATCAATC Gene: ASA_2695: TonB-dependent heme receptor HutR Site: position = -90 score = 5.21701 sequence = AAATGAGAATGATTCCCTTTA Site: position = -31 score = 4.82069 sequence = GTTTGATAACAGTTCTCAATA Gene: ASA_3328: TonB-dependent heme receptor HutR |
|
TonB-dependent heme receptor HutR |
| CRON 15. | |||||||
| AHA_0461 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -112 score = 5.82195 sequence = TAATGAAAATCAATATCATTA Gene: AHA_0461: Ferrichrome-iron receptor |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -110 score = 5.82195 sequence = TAATGAAAATCAATATCATTA Gene: ASA_3883: Ferrichrome-iron receptor |
|
Ferrichrome-iron receptor |
| CRON 16. | |||||||
| AHA_1964 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -93 score = 5.8091 sequence = AAATGACAATTCTTATCATTT Gene: AHA_1964: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -93 score = 5.73962 sequence = AAATGACAATTTTTATCATTT Gene: ASA_1845: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
|
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
| CRON 17. | |||||||
| entD |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -84 score = 5.8091 sequence = AAATGATAAGAATTGTCATTT Gene: AHA_1965: 4'-phosphopantetheinyl transferase entD (EC 2.7.8.-) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -86 score = 5.73962 sequence = AAATGATAAAAATTGTCATTT Gene: ASA_1846: 4'-phosphopantetheinyl transferase entD (EC 2.7.8.-) |
|
4'-phosphopantetheinyl transferase entD (EC 2.7.8.-) |
| CRON 18. | |||||||
| Tola_0678 |
|
|
|
|
|
*
Tolumonas auensis DSM 9187 Site: position = -54 score = 5.76218 sequence = TATTGAGAATAATTATCAATA Gene: Tola_0678: TonB-dependent receptor |
TonB-dependent receptor |
| PE36_17585 |
|
|
*
Moritella sp. PE36 Site: position = -35 score = 5.53547 sequence = TAATACGAACAATTATCATTT Gene: PE36_17585: Ferric anguibactin-binding protein |
|
|
Gene: Tola_0677: Ferric anguibactin-binding protein |
Ferric anguibactin-binding protein |
| PE36_17590 |
|
|
Gene: PE36_17590: catechol siderophore ABC transporter, permease protein |
|
Gene: ASA_4372: catechol siderophore ABC transporter, permease protein |
Gene: Tola_0676: catechol siderophore ABC transporter, permease protein |
catechol siderophore ABC transporter, permease protein |
| PE36_17595 |
|
|
Gene: PE36_17595: ferric anguibactin transport system permease protein FatC |
|
Gene: ASA_4371: ferric anguibactin transport system permease protein FatC |
Gene: Tola_0675: ferric anguibactin transport system permease protein FatC |
ferric anguibactin transport system permease protein FatC |
| PE36_17600 |
|
|
Gene: PE36_17600: ferric anguibactin transport ATP-binding protein |
|
Gene: ASA_4370: ferric anguibactin transport ATP-binding protein |
Gene: Tola_0674: ferric anguibactin transport ATP-binding protein |
ferric anguibactin transport ATP-binding protein |
| Tola_0673 |
|
|
|
|
|
Gene: Tola_0673: ABC transporter domain protein |
ABC transporter domain protein |
| PE36_17605 |
|
|
Gene: PE36_17605: vulnibactin utilization protein ViuB |
|
|
|
vulnibactin utilization protein ViuB |
| CRON 19. | |||||||
| PE36_21674 |
|
|
*
Moritella sp. PE36 Site: position = -71 score = 5.61407 sequence = TAGTGACAATGATTCTCATTT Gene: PE36_21674: permease |
|
|
|
permease |
| PE36_21669 |
|
|
Gene: PE36_21669: probable TonB-dependent receptor |
|
|
|
probable TonB-dependent receptor |
| PE36_21664 |
|
|
Gene: PE36_21664: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
|
|
|
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| PE36_21659 |
|
|
Gene: PE36_21659: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
|
|
|
ABC-type Fe3+-hydroxamate transport system, periplasmic component |
| PE36_21654 |
|
|
Gene: PE36_21654: ferrichrome transport system permease protein FhuB |
|
|
|
ferrichrome transport system permease protein FhuB |
| CRON 20. | |||||||
| hugW |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -42 score = 5.33267 sequence = TATTGATAGTGGTTATCATTT Gene: AHA_1982: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -51 score = 5.48799 sequence = AATTGATAGTGGTTATCATTT Gene: ASA_1862: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
|
Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
| CRON 21. | |||||||
| feoA |
|
Gene: PCNPT3_04751: Ferrous iron transport protein A |
Gene: PE36_13484: Ferrous iron transport protein A |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -38 score = 5.01116 sequence = AAAAGAGAATTATTATTGTTT Gene: AHA_2744: Ferrous iron transport protein A |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -38 score = 4.64855 sequence = AAAAGCGAATTATTATTGTTT Gene: ASA_1629: Ferrous iron transport protein A |
*
Tolumonas auensis DSM 9187 Site: position = -35 score = 5.4523 sequence = TATTAATAATGATTCTCAATA Gene: Tola_2146: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
|
Gene: PCNPT3_04756: Ferrous iron transport protein B |
Gene: PE36_13479: Ferrous iron transport protein B |
Gene: AHA_2743: Ferrous iron transport protein B |
Gene: ASA_1630: Ferrous iron transport protein B |
Gene: Tola_2145: Ferrous iron transport protein B |
Ferrous iron transport protein B |
| feoC |
|
Gene: PCNPT3_04761: Ferrous iron transport protein C |
Gene: PE36_13474: Ferrous iron transport protein C |
Gene: AHA_2742: Ferrous iron transport protein C |
Gene: ASA_1631: Ferrous iron transport protein C |
Gene: Tola_2144: Ferrous iron transport protein C |
Ferrous iron transport protein C |
| CRON 22. | |||||||
| AHA_3963 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -189 score = 6.01409 sequence = TAATGAGATTAATTATCATTT Gene: AHA_3963: TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
|
|
TonB-dependent receptor; Outer membrane receptor for ferrienterochelin and colicins |
| CRON 23. | |||||||
| tonB1 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -123 score = 4.58819 sequence = GATTGATAATGGTTGTTGTTT Gene: AHA_1987: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -33 score = 4.90053 sequence = GATTGATAATAGTTATTGTTT Gene: ASA_1867: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Tolumonas auensis DSM 9187 Site: position = -79 score = 5.88429 sequence = AAATAATAATGGTTCTCATTA Gene: Tola_1802: Ferric siderophore transport system, periplasmic binding protein TonB |
Ferric siderophore transport system, periplasmic binding protein TonB |
| exbB1 |
|
|
|
Gene: AHA_1986: Biopolymer transport protein ExbB |
Gene: ASA_1866: Biopolymer transport protein ExbB |
Gene: Tola_1801: Biopolymer transport protein ExbB |
Ferric siderophore transport system, biopolymer transport protein ExbB |
| exbD1 |
|
|
|
Gene: AHA_1985: Biopolymer transport protein ExbD |
Gene: ASA_1865: Biopolymer transport protein ExbD |
Gene: Tola_1800: Biopolymer transport protein ExbD |
Ferric siderophore transport system, biopolymer transport protein ExbD |
| CRON 24. | |||||||
| fstB |
|
|
|
|
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -94 score = 5.83651 sequence = AAATGATATTCATTTTTATTT Site: position = -100 score = 4.87526 sequence = AGATACAAATGATATTCATTT Gene: ASA_4368: Ferrichrome-iron receptor |
|
Ferrichrome-iron receptor |
| CRON 25. | |||||||
| PE36_01637 |
|
|
*
Moritella sp. PE36 Site: position = -108 score = 4.82923 sequence = TAATGAAAATGGTAATGATTA Site: position = -102 score = 5.83511 sequence = AAATGGTAATGATTATCAATT Gene: PE36_01637: putative putative ferrichrome-iron receptor |
|
|
|
putative putative ferrichrome-iron receptor |
| CRON 26. | |||||||
| PE36_11667 |
|
|
*
Moritella sp. PE36 Site: position = -53 score = 5.7981 sequence = AATTGATAATAAATCTCATTA Site: position = -70 score = 4.75089 sequence = TAATGATTTTTATTTGCAATT Site: position = -76 score = 4.89319 sequence = CTGTGATAATGATTTTTATTT Gene: PE36_11667: hypothetical protein |
|
|
|
hypothetical protein |
| PE36_11662 |
|
|
Gene: PE36_11662: ABC transporter, ATP-binding protein |
|
|
|
ABC transporter, ATP-binding protein |
| CRON 27. | |||||||
| PE36_10008 |
|
|
*
Moritella sp. PE36 Site: position = -197 score = 4.51615 sequence = TAAAGATTATCTTTTTCATTT Site: position = -85 score = 5.73742 sequence = AATTGCGAATAGTTTTCATTT Gene: PE36_10008: hypothetical protein |
Gene: AHA_0741: hypothetical protein |
Gene: ASA_3611: hypothetical protein |
|
hypothetical protein |
| CRON 28. | |||||||
| PCNPT3_10053 |
|
*
Psychromonas sp. CNPT3 Site: position = -57 score = 5.73742 sequence = AATTGCAAATAATTCTCATTA Gene: PCNPT3_10053: ABC transporter ATP-binding protein |
*
Moritella sp. PE36 Site: position = -42 score = 4.61343 sequence = TATTGGTTATCATTCTCATCA Gene: PE36_21074: ABC transporter ATP-binding protein |
|
|
|
ABC transporter ATP-binding protein |
| PE36_21069 |
|
|
Gene: PE36_21069: putative Iron-compound ABC transporter, permease protein |
|
|
|
putative Iron-compound ABC transporter, permease protein |
| PE36_21064 |
|
|
Gene: PE36_21064: iron(III) dicitrate transport system permease protein |
|
|
|
iron(III) dicitrate transport system permease protein |
| PE36_21059 |
|
|
Gene: PE36_21059: putative ferrichrome-binding protein |
|
|
|
putative ferrichrome-binding protein |
| CRON 29. | |||||||
| ftr1 |
|
*
Psychromonas sp. CNPT3 Site: position = -58 score = 5.69358 sequence = TAATGGTAATTATTATCAATT Gene: PCNPT3_00271: High-affinity Fe2+/Pb2+ permease |
|
|
|
|
High-affinity Fe2+/Pb2+ permease |
| PCNPT3_00266 |
|
Gene: PCNPT3_00266: Periplasmic protein p19 involved in high-affinity Fe2+ transport |
|
|
|
|
Periplasmic protein p19 involved in high-affinity Fe2+ transport |
| CRON 30. | |||||||
| PE36_09918 |
|
|
*
Moritella sp. PE36 Site: position = -79 score = 5.66441 sequence = AAATGAGAATTATTCTTATAA Gene: PE36_09918: Transcriptional regulator, AraC family |
Gene: AHA_1952: Transcriptional regulator, AraC family |
Gene: ASA_2342: Transcriptional regulator, AraC family |
|
Transcriptional regulator, AraC family |
| CRON 31. | |||||||
| irpA |
*
Psychromonas ingrahamii 37 Site: position = -56 score = 4.85665 sequence = TAATGATAATCAATACTATTC Site: position = -62 score = 4.71873 sequence = TTTTGATAATGATAATCAATA Gene: Ping_0688: Iron-regulated protein A precursor |
|
*
Moritella sp. PE36 Site: position = -57 score = 4.84459 sequence = CAATGCAAATAACTATCATTA Site: position = -80 score = 5.65623 sequence = TAATGATAATAATTATTATTC Gene: PE36_01255: Iron-regulated protein A precursor |
|
|
|
Iron-regulated protein A precursor |
| CRON 32. | |||||||
| PCNPT3_09369 |
|
*
Psychromonas sp. CNPT3 Site: position = -59 score = 5.64244 sequence = GAATAATAATGATTATCATTA Gene: PCNPT3_09369: Putative periplasmic substrate-binding transport protein |
|
|
|
|
Putative periplasmic substrate-binding transport protein |
| PCNPT3_09374 |
|
Gene: PCNPT3_09374: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
|
|
|
|
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
| PCNPT3_09379 |
|
Gene: PCNPT3_09379: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
|
|
|
|
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| CRON 33. | |||||||
| PE36_21679 |
|
|
*
Moritella sp. PE36 Site: position = -55 score = 5.61407 sequence = AAATGAGAATCATTGTCACTA Gene: PE36_21679: putative siderophore biosynthesis protein IucC |
|
|
|
putative siderophore biosynthesis protein IucC |
| CRON 34. | |||||||
| PE36_09923 |
|
|
*
Moritella sp. PE36 Site: position = -46 score = 5.56794 sequence = GAACGATAATAATTATCATTT Gene: PE36_09923: ferrichrome-iron receptor |
|
|
|
ferrichrome-iron receptor |
| CRON 35. | |||||||
| PE36_17310 |
|
|
*
Moritella sp. PE36 Site: position = -75 score = 5.45503 sequence = GAATGATAGTAATTCTCATTT Gene: PE36_17310: heme transport protein HutA |
|
|
|
heme transport protein HutA |
| CRON 36. | |||||||
| Tola_1488 |
|
|
|
|
|
*
Tolumonas auensis DSM 9187 Site: position = -68 score = 5.44644 sequence = TAATGCGAATGGTTATCAATA Gene: Tola_1488: TonB-dependent siderophore receptor |
TonB-dependent siderophore receptor |
| CRON 37. | |||||||
| PE36_08636 |
|
|
*
Moritella sp. PE36 Site: position = -139 score = 5.41284 sequence = TTATGATAATAATTTTTATCT Gene: PE36_08636: hypothetical outer membrane protein |
|
|
|
hypothetical outer membrane protein |
| CRON 38. | |||||||
| AHA_1953 |
|
|
|
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -43 score = 4.86 sequence = AAATGAGATTTGTTACTATTC Gene: AHA_1953: Ferrichrome-iron receptor |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -47 score = 5.40839 sequence = AAATGAGATTTGTTACCATTA Gene: ASA_2341: Ferrichrome-iron receptor |
|
Ferrichrome-iron receptor |
| AHA_1954 |
|
|
|
Gene: AHA_1954: Hypothetical protein in aerobactin uptake cluster |
Gene: ASA_2340: Hypothetical protein in aerobactin uptake cluster |
|
Hypothetical protein in aerobactin uptake cluster |
| CRON 39. | |||||||
| hemC |
Gene: Ping_3642: Porphobilinogen deaminase (EC 2.5.1.61) |
Gene: PCNPT3_01645: Porphobilinogen deaminase (EC 2.5.1.61) |
Gene: PE36_15764: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -105 score = 4.77445 sequence = TAATAAAAATCATTTTCAGCG Gene: AHA_0469: Porphobilinogen deaminase (EC 2.5.1.61) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -105 score = 5.39232 sequence = TAATGAAAATCATTTTCAGCA Gene: ASA_3875: Porphobilinogen deaminase (EC 2.5.1.61) |
Gene: Tola_3127: Porphobilinogen deaminase (EC 2.5.1.61) |
Porphobilinogen deaminase (EC 2.5.1.61) |
| hemD |
Gene: Ping_3641: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: PCNPT3_01650: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: PE36_15759: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: AHA_0468: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: ASA_3876: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Gene: Tola_3128: Uroporphyrinogen-III synthase (EC 4.2.1.75) |
Uroporphyrinogen-III synthase (EC 4.2.1.75) |
| hemX |
Gene: Ping_3640: uroporphyrin-III C-methyltransferase HemX |
Gene: PCNPT3_01655: uroporphyrin-III C-methyltransferase HemX |
Gene: PE36_15754: uroporphyrin-III C-methyltransferase HemX |
Gene: AHA_0467: uroporphyrin-III C-methyltransferase HemX |
Gene: ASA_3877: uroporphyrin-III C-methyltransferase HemX |
Gene: Tola_3129: uroporphyrin-III C-methyltransferase HemX |
uroporphyrin-III C-methyltransferase HemX |
| hemY |
Gene: Ping_3639: HemY protein |
Gene: PCNPT3_01660: HemY protein |
Gene: PE36_15749: HemY protein |
Gene: AHA_0466: HemY protein |
Gene: ASA_3878: HemY protein |
Gene: Tola_3130: HemY protein |
HemY protein |
| CRON 40. | |||||||
| PCNPT3_00166 |
|
*
Psychromonas sp. CNPT3 Site: position = -162 score = 5.37342 sequence = TGGTGATAATGGTTATCATTA Gene: PCNPT3_00166: TonB system biopolymer transport component |
*
Moritella sp. PE36 Site: position = -106 score = 4.86807 sequence = TAAATACAATGATTCTCATTT Gene: PE36_07037: TonB system biopolymer transport component |
|
|
|
TonB system biopolymer transport component |
| PCNPT3_00171 |
|
Gene: PCNPT3_00171: MotA/TolQ/ExbB proton channel family protein |
Gene: PE36_07032: MotA/TolQ/ExbB proton channel family protein |
|
|
|
MotA/TolQ/ExbB proton channel family protein |
| exbB2 |
|
Gene: PCNPT3_00176: Biopolymer transport protein ExbB |
Gene: PE36_07027: Biopolymer transport protein ExbB |
|
|
|
Biopolymer transport protein ExbB |
| exbD2 |
|
Gene: PCNPT3_00181: Biopolymer transport protein ExbD |
Gene: PE36_07022: Biopolymer transport protein ExbD |
|
|
|
Biopolymer transport protein ExbD |
| tonB2 |
|
Gene: PCNPT3_00186: TonB protein |
Gene: PE36_07017: TonB protein |
|
|
|
TonB protein |
| PCNPT3_00191 |
|
Gene: PCNPT3_00191: TPR domain protein, putative component of TonB system |
Gene: PE36_07012: TPR domain protein, putative component of TonB system |
|
|
|
TPR domain protein, putative component of TonB system |
| CRON 41. | |||||||
| Tola_2912 |
|
|
|
|
|
*
Tolumonas auensis DSM 9187 Site: position = -95 score = 5.29473 sequence = AGATGAAAAGGGTTATCAATA Gene: Tola_2912: ferric uptake regulator family protein |
ferric uptake regulator family protein |
| CRON 42. | |||||||
| PE36_21054 |
|
|
*
Moritella sp. PE36 Site: position = -81 score = 5.28269 sequence = AAATAAGAACGATTCCTATTT Gene: PE36_21054: TonB-dependent receptor |
|
|
|
TonB-dependent receptor |
| CRON 43. | |||||||
| PE36_19050 |
|
|
*
Moritella sp. PE36 Site: position = -88 score = 5.26168 sequence = TAATGGTAATAATTATCAGTA Gene: PE36_19050: outer membrane ferric siderophore receptor, putative |
|
|
|
outer membrane ferric siderophore receptor, putative |
| CRON 44. | |||||||
| Ping_1736 |
Gene: Ping_1736: Uncharacterized iron-regulated protein |
|
Gene: PE36_20315: Uncharacterized iron-regulated protein |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -178 score = 4.82069 sequence = TATTGAGAACTGTTATCAAAC Site: position = -119 score = 4.70578 sequence = TAAACGGAATCATTCTCATTT Gene: AHA_0971: Uncharacterized iron-regulated protein |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -177 score = 4.82069 sequence = TATTGAGAACTGTTATCAAAC Site: position = -118 score = 5.21701 sequence = TAAAGGGAATCATTCTCATTT Gene: ASA_3329: Uncharacterized iron-regulated protein |
|
Uncharacterized iron-regulated protein |
| AHA_0970 |
|
|
|
Gene: AHA_0970: Isochorismatase (EC 3.3.2.1) |
Gene: ASA_3330: Isochorismatase (EC 3.3.2.1) |
|
Isochorismatase (EC 3.3.2.1) |
| AHA_0969 |
|
|
|
Gene: AHA_0969: hypothetical protein |
Gene: ASA_3331: hypothetical protein |
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |