Regulon of Fur in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_2824
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	55
- Operons	24
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 4.9 Sequence: GATTGATAATAGTTATTGTTT Locus tag: ASA_1867 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: ASA_1866 Name: exbB1 Funciton: Biopolymer transport protein ExbB Locus tag: ASA_1865 Name: exbD1 Funciton: Biopolymer transport protein ExbD
	ASA_1867	tonB1	Ferric siderophore transport system, periplasmic binding protein TonB
	ASA_1866	exbB1	Biopolymer transport protein ExbB
	ASA_1865	exbD1	Biopolymer transport protein ExbD
Position: -51 Score: 5.5 Sequence: AATTGATAGTGGTTATCATTT Locus tag: ASA_1862 Name: hugW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
	ASA_1862	hugW	Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Position: -38 Score: 4.6 Sequence: AAAAGCGAATTATTATTGTTT Locus tag: ASA_1629 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: ASA_1630 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: ASA_1631 Name: feoC Funciton: Ferrous iron transport protein C
	ASA_1629	feoA	Ferrous iron transport protein A
	ASA_1630	feoB	Ferrous iron transport protein B
	ASA_1631	feoC	Ferrous iron transport protein C
Position: -80 Score: 5.7 Sequence: AAATAAAAATGATTACCATTT Locus tag: ASA_1851 Name: AHA_1970 Funciton: hypothetical protein Locus tag: ASA_1850 Name: fstC Funciton: Colicin I receptor precursor Locus tag: ASA_1849 Name: AHA_1968 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: ASA_1848 Name: AHA_1967 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: ASA_1847 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	ASA_1851	AHA_1970	hypothetical protein
	ASA_1850	fstC	Colicin I receptor precursor
	ASA_1849	AHA_1968	ABC-type Fe3+-siderophore transport system, permease component
	ASA_1848	AHA_1967	ABC-type Fe3+-siderophore transport system, permease component
	ASA_1847	fecE	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Position: -100 Score: 4.9 Sequence: AGATACAAATGATATTCATTT Position: -94 Score: 5.8 Sequence: AAATGATATTCATTTTTATTT Locus tag: ASA_4368 Name: fstB Funciton: Ferrichrome-iron receptor
	ASA_4368	fstB	Ferrichrome-iron receptor
Position: -93 Score: 5.7 Sequence: AAATGACAATTTTTATCATTT Locus tag: ASA_1845 Name: null Funciton: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
	ASA_1845		Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
Position: -86 Score: 5.7 Sequence: AAATGATAAAAATTGTCATTT Locus tag: ASA_1846 Name: entD Funciton: 4'-phosphopantetheinyl transferase entD (EC 2.7.8.-)
	ASA_1846	entD	4'-phosphopantetheinyl transferase entD (EC 2.7.8.-)
Position: -110 Score: 5.8 Sequence: TAATGAAAATCAATATCATTA Locus tag: ASA_3883 Name: null Funciton: Ferrichrome-iron receptor
	ASA_3883		Ferrichrome-iron receptor
Position: -115 Score: 5.9 Sequence: AAATGATAATGATTATCAATC Position: -47 Score: 5.1 Sequence: AAATAACAATCATTCTCAAAA Locus tag: ASA_2695 Name: hutR Funciton: TonB-dependent heme receptor HutR
	ASA_2695	hutR	TonB-dependent heme receptor HutR
Position: -92 Score: 5 Sequence: AATTGATAATCGCTTTCATTC Locus tag: ASA_3334 Name: hutB Funciton: Hemin ABC transport system, periplasmic component Locus tag: ASA_3335 Name: hutC Funciton: Hemin ABC transporter, permease protein Locus tag: ASA_3336 Name: hutD Funciton: Hemin ABC transporter, ATP-binding protein
	ASA_3334	hutB	Hemin ABC transport system, periplasmic component
	ASA_3335	hutC	Hemin ABC transporter, permease protein
	ASA_3336	hutD	Hemin ABC transporter, ATP-binding protein
Position: -60 Score: 6.1 Sequence: AATTGATAATAGTTTTCATTT Locus tag: ASA_3006 Name: null Funciton: iron-chelator utilization protein
	ASA_3006		iron-chelator utilization protein
Position: -119 Score: 6.3 Sequence: AATTGATAATCATTATCATTT Locus tag: ASA_1838 Name: entC Funciton: Isochorismate synthase (EC 5.4.4.2) Locus tag: ASA_1839 Name: entE Funciton: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) Locus tag: ASA_1840 Name: entB Funciton: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis Locus tag: ASA_1841 Name: entF Funciton: Enterobactin synthetase component F (EC 2.7.7.-) Locus tag: ASA_1842 Name: entA Funciton: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
	ASA_1838	entC	Isochorismate synthase (EC 5.4.4.2)
	ASA_1839	entE	2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58)
	ASA_1840	entB	Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis
	ASA_1841	entF	Enterobactin synthetase component F (EC 2.7.7.-)
	ASA_1842	entA	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
Position: -61 Score: 6.1 Sequence: AATTGATAACAATTATCATTT Locus tag: ASA_0706 Name: mntH Funciton: Manganese transport protein MntH
	ASA_0706	mntH	Manganese transport protein MntH
Position: -97 Score: 5 Sequence: GAATGAAAGCGATTATCAATT Locus tag: ASA_3333 Name: hutX Funciton: Putative heme iron utilization protein Locus tag: ASA_3332 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	ASA_3333	hutX	Putative heme iron utilization protein
	ASA_3332	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -70 Score: 6.1 Sequence: AGATGAGAATAGTTTTCATTT Locus tag: ASA_3536 Name: COG3205 Funciton: Predicted membrane protein
	ASA_3536	COG3205	Predicted membrane protein
Position: -80 Score: 5.5 Sequence: AATTGATAACTCTTTTCATTA Locus tag: ASA_2551 Name: null Funciton: hypothetical protein
	ASA_2551		hypothetical protein
Position: -71 Score: 5.1 Sequence: TAATGCACACCATTCTCATTT Locus tag: ASA_1836 Name: null Funciton: hypothetical protein
	ASA_1836		hypothetical protein
Position: -35 Score: 5.4 Sequence: CAATGAGAATAGTTATCATTG Locus tag: ASA_4323 Name: PE36_02307 Funciton: TonB system biopolymer transport component; Chromosome segregation ATPase Locus tag: ASA_4322 Name: AHA_4251 Funciton: TonB system biopolymer transport component Locus tag: ASA_4321 Name: exbB2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbB Locus tag: ASA_4320 Name: exbD2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbD Locus tag: ASA_4319 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: ASA_4318 Name: PE36_02282 Funciton: TPR domain protein, putative component of TonB system
	ASA_4323	PE36_02307	TonB system biopolymer transport component; Chromosome segregation ATPase
	ASA_4322	AHA_4251	TonB system biopolymer transport component
	ASA_4321	exbB2	Ferric siderophore transport system, biopolymer transport protein ExbB
	ASA_4320	exbD2	Ferric siderophore transport system, biopolymer transport protein ExbD
	ASA_4319	tonB2	Ferric siderophore transport system, periplasmic binding protein TonB
	ASA_4318	PE36_02282	TPR domain protein, putative component of TonB system
Position: -177 Score: 4.8 Sequence: TATTGAGAACTGTTATCAAAC Position: -118 Score: 5.2 Sequence: TAAAGGGAATCATTCTCATTT Locus tag: ASA_3329 Name: Ping_1736 Funciton: Uncharacterized iron-regulated protein Locus tag: ASA_3330 Name: null Funciton: Isochorismatase (EC 3.3.2.1) Locus tag: ASA_3331 Name: null Funciton: hypothetical protein
	ASA_3329	Ping_1736	Uncharacterized iron-regulated protein
	ASA_3330		Isochorismatase (EC 3.3.2.1)
	ASA_3331		hypothetical protein
Position: -105 Score: 5.4 Sequence: TAATGAAAATCATTTTCAGCA Locus tag: ASA_3875 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: ASA_3876 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: ASA_3877 Name: hemX Funciton: uroporphyrin-III C-methyltransferase HemX Locus tag: ASA_3878 Name: hemY Funciton: HemY protein
	ASA_3875	hemC	Porphobilinogen deaminase (EC 2.5.1.61)
	ASA_3876	hemD	Uroporphyrinogen-III synthase (EC 4.2.1.75)
	ASA_3877	hemX	uroporphyrin-III C-methyltransferase HemX
	ASA_3878	hemY	HemY protein
Position: -47 Score: 5.4 Sequence: AAATGAGATTTGTTACCATTA Locus tag: ASA_2341 Name: null Funciton: Ferrichrome-iron receptor Locus tag: ASA_2340 Name: null Funciton: Hypothetical protein in aerobactin uptake cluster
	ASA_2341		Ferrichrome-iron receptor
	ASA_2340		Hypothetical protein in aerobactin uptake cluster
Position: -155 Score: 5.3 Sequence: AGATGCAAATGATTAGCAATT Locus tag: ASA_4363 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: ASA_4364 Name: fhuB Funciton: ABC transporter ATP-binding protein YojI Locus tag: ASA_4365 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: ASA_4366 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: ASA_4367 Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
	ASA_4363	fhuA	Ferric hydroxamate outer membrane receptor FhuA
	ASA_4364	fhuB	ABC transporter ATP-binding protein YojI
	ASA_4365	fhuC	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
	ASA_4366	fhuD	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
	ASA_4367	fhuE	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
Position: -35 Score: 6.2 Sequence: AAATAATAATTATTATCATTT Locus tag: ASA_3720 Name: null Funciton: FOG: TPR repeat Locus tag: ASA_3721 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
	ASA_3720		FOG: TPR repeat
	ASA_3721	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
Position: -90 Score: 5.2 Sequence: AAATGAGAATGATTCCCTTTA Position: -31 Score: 4.8 Sequence: GTTTGATAACAGTTCTCAATA Locus tag: ASA_3328 Name: hutR Funciton: TonB-dependent heme receptor HutR
	ASA_3328	hutR	TonB-dependent heme receptor HutR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Aeromonas salmonicida subsp. salmonicida A449

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --