Regulon of Fur in Tolumonas auensis DSM 9187

Properties
Regulator type:	Transcription factor
TF locus tag:	Tola_0857
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	21
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5.3 Sequence: AGATGAAAAGGGTTATCAATA Locus tag: Tola_2912 Name: null Funciton: ferric uptake regulator family protein
	Tola_2912		ferric uptake regulator family protein
Position: -79 Score: 5.9 Sequence: AAATAATAATGGTTCTCATTA Locus tag: Tola_1802 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: Tola_1801 Name: exbB1 Funciton: Biopolymer transport protein ExbB Locus tag: Tola_1800 Name: exbD1 Funciton: Biopolymer transport protein ExbD
	Tola_1802	tonB1	Ferric siderophore transport system, periplasmic binding protein TonB
	Tola_1801	exbB1	Biopolymer transport protein ExbB
	Tola_1800	exbD1	Biopolymer transport protein ExbD
Position: -35 Score: 5.5 Sequence: TATTAATAATGATTCTCAATA Locus tag: Tola_2146 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Tola_2145 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: Tola_2144 Name: feoC Funciton: Ferrous iron transport protein C
	Tola_2146	feoA	Ferrous iron transport protein A
	Tola_2145	feoB	Ferrous iron transport protein B
	Tola_2144	feoC	Ferrous iron transport protein C
Position: -54 Score: 5.8 Sequence: TATTGAGAATAATTATCAATA Locus tag: Tola_0678 Name: null Funciton: TonB-dependent receptor Locus tag: Tola_0677 Name: PE36_17585 Funciton: Ferric anguibactin-binding protein Locus tag: Tola_0676 Name: PE36_17590 Funciton: catechol siderophore ABC transporter, permease protein Locus tag: Tola_0675 Name: PE36_17595 Funciton: ferric anguibactin transport system permease protein FatC Locus tag: Tola_0674 Name: PE36_17600 Funciton: ferric anguibactin transport ATP-binding protein Locus tag: Tola_0673 Name: null Funciton: ABC transporter domain protein
	Tola_0678		TonB-dependent receptor
	Tola_0677	PE36_17585	Ferric anguibactin-binding protein
	Tola_0676	PE36_17590	catechol siderophore ABC transporter, permease protein
	Tola_0675	PE36_17595	ferric anguibactin transport system permease protein FatC
	Tola_0674	PE36_17600	ferric anguibactin transport ATP-binding protein
	Tola_0673		ABC transporter domain protein
Position: -60 Score: 5.9 Sequence: AATTGATAACAATTATCATCT Locus tag: Tola_1485 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: Tola_1486 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: Tola_1487 Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
	Tola_1485	fhuC	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
	Tola_1486	fhuD	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
	Tola_1487	fhuE	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
Position: -38 Score: 5.1 Sequence: TAATGGGAATAGTTATCAGTA Locus tag: Tola_1489 Name: fhuB Funciton: ABC transporter ATP-binding protein YojI
	Tola_1489	fhuB	ABC transporter ATP-binding protein YojI
Position: -87 Score: 5.6 Sequence: AAACGATATTTATTTTCATTT Position: -60 Score: 5.5 Sequence: AAATGATATCCGTTCTCATAT Position: -37 Score: 5.8 Sequence: TTATGATAATGATTCTCATTA Locus tag: Tola_2559 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: Tola_2558 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: Tola_2557 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	Tola_2559	fbpA	Ferric iron ABC transporter, iron-binding protein
	Tola_2558	fbpB	Ferric iron ABC transporter, permease protein
	Tola_2557	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -68 Score: 5.4 Sequence: TAATGCGAATGGTTATCAATA Locus tag: Tola_1488 Name: null Funciton: TonB-dependent siderophore receptor
	Tola_1488		TonB-dependent siderophore receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Tolumonas auensis DSM 9187

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --