Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fhuA gene

Properties
Regulog: Fur - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -134
Score: 5.28778
Sequence: AGATGCAAATGATTAGCAATT
Locus tag: AHA_4275
Name: null
Funciton: Ferric hydroxamate outer membrane receptor FhuA
Locus tag: AHA_4276
Name: fhuB
Funciton: ABC transporter ATP-binding protein YojI
Locus tag: AHA_4277
Name: fhuC
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: AHA_4278
Name: fhuD
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: AHA_4279
Name: fhuE
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
AHA_4275-fhuB-fhuC-fhuD-fhuE -134 5.3 AGATGCAAATGATTAGCAATT AHA_4275
Aeromonas salmonicida subsp. salmonicida A449
Position: -155
Score: 5.28778
Sequence: AGATGCAAATGATTAGCAATT
Locus tag: ASA_4363
Name: fhuA
Funciton: Ferric hydroxamate outer membrane receptor FhuA
Locus tag: ASA_4364
Name: fhuB
Funciton: ABC transporter ATP-binding protein YojI
Locus tag: ASA_4365
Name: fhuC
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: ASA_4366
Name: fhuD
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: ASA_4367
Name: fhuE
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
fhuA-fhuB-fhuC-fhuD-fhuE -155 5.3 AGATGCAAATGATTAGCAATT ASA_4363