Regulon of Fur in Psychromonas sp. CNPT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PCNPT3_04167
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	23
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.6 Sequence: GAATAATAATGATTATCATTA Locus tag: PCNPT3_09369 Name: null Funciton: Putative periplasmic substrate-binding transport protein Locus tag: PCNPT3_09374 Name: null Funciton: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) Locus tag: PCNPT3_09379 Name: null Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	PCNPT3_09369		Putative periplasmic substrate-binding transport protein
	PCNPT3_09374		Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
	PCNPT3_09379		Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Position: -80 Score: 5.2 Sequence: TCATGATAATGATTATCGTTT Position: -74 Score: 5.1 Sequence: TAATGATTATCGTTTGCATTT Locus tag: PCNPT3_07645 Name: sitA Funciton: Manganese ABC transporter, periplasmic-binding protein SitA Locus tag: PCNPT3_07650 Name: sitB Funciton: Manganese ABC transporter, ATP-binding protein SitB Locus tag: PCNPT3_07655 Name: sitC Funciton: Manganese ABC transporter, inner membrane permease protein SitC Locus tag: PCNPT3_07660 Name: sitD Funciton: Manganese ABC transporter, inner membrane permease protein SitD
	PCNPT3_07645	sitA	Manganese ABC transporter, periplasmic-binding protein SitA
	PCNPT3_07650	sitB	Manganese ABC transporter, ATP-binding protein SitB
	PCNPT3_07655	sitC	Manganese ABC transporter, inner membrane permease protein SitC
	PCNPT3_07660	sitD	Manganese ABC transporter, inner membrane permease protein SitD
Position: -156 Score: 5 Sequence: TATTGATAATGACTTTCATTG Position: -111 Score: 5.4 Sequence: GAATGAGAACTATTCTCGTTT Locus tag: PCNPT3_11763 Name: null Funciton: hypothetical protein Locus tag: PCNPT3_11758 Name: null Funciton: hypothetical protein Locus tag: PCNPT3_11733 Name: null Funciton: hypothetical protein
	PCNPT3_11763		hypothetical protein
	PCNPT3_11758		hypothetical protein
	PCNPT3_11733		hypothetical protein
Position: -91 Score: 4.9 Sequence: AAATGATAGTGATTATTGTTA Position: -85 Score: 5.1 Sequence: TAGTGATTATTGTTATCATTT Locus tag: PCNPT3_08705 Name: fecF Funciton: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein Locus tag: PCNPT3_08710 Name: fecD Funciton: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) Locus tag: PCNPT3_08715 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	PCNPT3_08705	fecF	Iron(III) dicitrate transport system periplasmic substrate-binding transport protein
	PCNPT3_08710	fecD	Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
	PCNPT3_08715	fecE	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Position: -162 Score: 5.4 Sequence: TGGTGATAATGGTTATCATTA Locus tag: PCNPT3_00166 Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component Locus tag: PCNPT3_00171 Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein Locus tag: PCNPT3_00176 Name: exbB2 Funciton: Biopolymer transport protein ExbB Locus tag: PCNPT3_00181 Name: exbD2 Funciton: Biopolymer transport protein ExbD Locus tag: PCNPT3_00186 Name: tonB2 Funciton: TonB protein Locus tag: PCNPT3_00191 Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system
	PCNPT3_00166	PCNPT3_00166	TonB system biopolymer transport component
	PCNPT3_00171	PCNPT3_00171	MotA/TolQ/ExbB proton channel family protein
	PCNPT3_00176	exbB2	Biopolymer transport protein ExbB
	PCNPT3_00181	exbD2	Biopolymer transport protein ExbD
	PCNPT3_00186	tonB2	TonB protein
	PCNPT3_00191	PCNPT3_00191	TPR domain protein, putative component of TonB system
Position: -58 Score: 5.7 Sequence: TAATGGTAATTATTATCAATT Locus tag: PCNPT3_00271 Name: ftr1 Funciton: High-affinity Fe2+/Pb2+ permease Locus tag: PCNPT3_00266 Name: null Funciton: Periplasmic protein p19 involved in high-affinity Fe2+ transport
	PCNPT3_00271	ftr1	High-affinity Fe2+/Pb2+ permease
	PCNPT3_00266		Periplasmic protein p19 involved in high-affinity Fe2+ transport
Position: -32 Score: 5.2 Sequence: AATTGATAATCATTATTACCA Locus tag: PCNPT3_11948 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
	PCNPT3_11948	fbpA	Ferric iron ABC transporter, iron-binding protein
Position: -57 Score: 5.7 Sequence: AATTGCAAATAATTCTCATTA Locus tag: PCNPT3_10053 Name: PCNPT3_10053 Funciton: ABC transporter ATP-binding protein
	PCNPT3_10053	PCNPT3_10053	ABC transporter ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Psychromonas sp. CNPT3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --