Orthologous regulated operons containing fecE gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: 109 Score: 5.72154 Sequence: AAATAAAAATGATTACCATTT Locus tag: AHA_1970 Name: AHA_1970 Funciton: hypothetical protein Locus tag: AHA_1969 Name: fstC Funciton: Colicin I receptor precursor Locus tag: AHA_1968 Name: AHA_1968 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: AHA_1967 Name: AHA_1967 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: AHA_1966 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
AHA_1970-fstC-AHA_1968-AHA_1967-fecE	109	5.7	AAATAAAAATGATTACCATTT	AHA_1970
Aeromonas salmonicida subsp. salmonicida A449
Position: -80 Score: 5.72154 Sequence: AAATAAAAATGATTACCATTT Locus tag: ASA_1851 Name: AHA_1970 Funciton: hypothetical protein Locus tag: ASA_1850 Name: fstC Funciton: Colicin I receptor precursor Locus tag: ASA_1849 Name: AHA_1968 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: ASA_1848 Name: AHA_1967 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: ASA_1847 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
AHA_1970-fstC-AHA_1968-AHA_1967-fecE	-80	5.7	AAATAAAAATGATTACCATTT	ASA_1851

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --