Regulon of Fur in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_0873
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.9 Sequence: AAATGGTAATGATTATCATTA Position: -56 Score: 5.2 Sequence: TAATGATTATCATTATTATTA Position: -32 Score: 4.5 Sequence: TATCGTGAATTATTACCATTT Locus tag: Ping_3007 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: Ping_3006 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: Ping_3005 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	Ping_3007	fbpA	Ferric iron ABC transporter, iron-binding protein
	Ping_3006	fbpB	Ferric iron ABC transporter, permease protein
	Ping_3005	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -62 Score: 4.7 Sequence: TTTTGATAATGATAATCAATA Position: -56 Score: 4.9 Sequence: TAATGATAATCAATACTATTC Locus tag: Ping_0688 Name: irpA Funciton: Iron-regulated protein A precursor
	Ping_0688	irpA	Iron-regulated protein A precursor
Position: -57 Score: 6.2 Sequence: AAATGATAACAGTTATCATTT Locus tag: Ping_0309 Name: COG3205 Funciton: Predicted membrane protein
	Ping_0309	COG3205	Predicted membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD