Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PE36_21679 gene

Properties
Regulog: Fur - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Moritella sp. PE36
Position: -55
Score: 5.61407
Sequence: AAATGAGAATCATTGTCACTA
Locus tag: PE36_21679
Name: null
Funciton: putative siderophore biosynthesis protein IucC
PE36_21679 -55 5.6 AAATGAGAATCATTGTCACTA PE36_21679