Regulon of Fur in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_02509
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	58
- Operons	23
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 111 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 5.5 Sequence: GAATGATAGTAATTCTCATTT Locus tag: PE36_17310 Name: null Funciton: heme transport protein HutA
	PE36_17310		heme transport protein HutA
Position: -71 Score: 5.6 Sequence: TAGTGACAATGATTCTCATTT Locus tag: PE36_21674 Name: null Funciton: permease Locus tag: PE36_21669 Name: null Funciton: probable TonB-dependent receptor Locus tag: PE36_21664 Name: PE36_21664 Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) Locus tag: PE36_21659 Name: null Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: PE36_21654 Name: null Funciton: ferrichrome transport system permease protein FhuB
	PE36_21674		permease
	PE36_21669		probable TonB-dependent receptor
	PE36_21664	PE36_21664	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	PE36_21659		ABC-type Fe3+-hydroxamate transport system, periplasmic component
	PE36_21654		ferrichrome transport system permease protein FhuB
Position: -42 Score: 4.6 Sequence: TATTGGTTATCATTCTCATCA Locus tag: PE36_21074 Name: PCNPT3_10053 Funciton: ABC transporter ATP-binding protein Locus tag: PE36_21069 Name: null Funciton: putative Iron-compound ABC transporter, permease protein Locus tag: PE36_21064 Name: null Funciton: iron(III) dicitrate transport system permease protein Locus tag: PE36_21059 Name: null Funciton: putative ferrichrome-binding protein
	PE36_21074	PCNPT3_10053	ABC transporter ATP-binding protein
	PE36_21069		putative Iron-compound ABC transporter, permease protein
	PE36_21064		iron(III) dicitrate transport system permease protein
	PE36_21059		putative ferrichrome-binding protein
Position: -88 Score: 5.3 Sequence: TAATGGTAATAATTATCAGTA Locus tag: PE36_19050 Name: null Funciton: outer membrane ferric siderophore receptor, putative
	PE36_19050		outer membrane ferric siderophore receptor, putative
Position: -81 Score: 5.3 Sequence: AAATAAGAACGATTCCTATTT Locus tag: PE36_21054 Name: null Funciton: TonB-dependent receptor
	PE36_21054		TonB-dependent receptor
Position: -108 Score: 4.8 Sequence: TAATGAAAATGGTAATGATTA Position: -102 Score: 5.8 Sequence: AAATGGTAATGATTATCAATT Locus tag: PE36_01637 Name: null Funciton: putative putative ferrichrome-iron receptor
	PE36_01637		putative putative ferrichrome-iron receptor
Position: -76 Score: 4.9 Sequence: CTGTGATAATGATTTTTATTT Position: -70 Score: 4.8 Sequence: TAATGATTTTTATTTGCAATT Position: -53 Score: 5.8 Sequence: AATTGATAATAAATCTCATTA Locus tag: PE36_11667 Name: null Funciton: hypothetical protein Locus tag: PE36_11662 Name: null Funciton: ABC transporter, ATP-binding protein
	PE36_11667		hypothetical protein
	PE36_11662		ABC transporter, ATP-binding protein
Position: -46 Score: 5.6 Sequence: GAACGATAATAATTATCATTT Locus tag: PE36_09923 Name: null Funciton: ferrichrome-iron receptor
	PE36_09923		ferrichrome-iron receptor
Position: -55 Score: 5.6 Sequence: AAATGAGAATCATTGTCACTA Locus tag: PE36_21679 Name: null Funciton: putative siderophore biosynthesis protein IucC
	PE36_21679		putative siderophore biosynthesis protein IucC
Position: -150 Score: 5.2 Sequence: TAATGCAACCAATTCTCATTT Locus tag: PE36_06587 Name: hutB Funciton: Hemin ABC transport system, periplasmic component Locus tag: PE36_06582 Name: hutC Funciton: Hemin ABC transporter, permease protein Locus tag: PE36_06577 Name: hutD Funciton: Hemin ABC transporter, ATP-binding protein
	PE36_06587	hutB	Hemin ABC transport system, periplasmic component
	PE36_06582	hutC	Hemin ABC transporter, permease protein
	PE36_06577	hutD	Hemin ABC transporter, ATP-binding protein
Position: -85 Score: 6.3 Sequence: TAATGATAATAATTCTCATTT Locus tag: PE36_17360 Name: sitA Funciton: Manganese ABC transporter, periplasmic-binding protein SitA Locus tag: PE36_17355 Name: sitB Funciton: Manganese ABC transporter, ATP-binding protein SitB Locus tag: PE36_17350 Name: sitC Funciton: Manganese ABC transporter, inner membrane permease protein SitC Locus tag: PE36_17345 Name: sitD Funciton: Manganese ABC transporter, inner membrane permease protein SitD
	PE36_17360	sitA	Manganese ABC transporter, periplasmic-binding protein SitA
	PE36_17355	sitB	Manganese ABC transporter, ATP-binding protein SitB
	PE36_17350	sitC	Manganese ABC transporter, inner membrane permease protein SitC
	PE36_17345	sitD	Manganese ABC transporter, inner membrane permease protein SitD
Position: -86 Score: 5.2 Sequence: AAATGAGAATTGGTTGCATTA Locus tag: PE36_06592 Name: hutX Funciton: Putative heme iron utilization protein Locus tag: PE36_06597 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	PE36_06592	hutX	Putative heme iron utilization protein
	PE36_06597	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -103 Score: 4.9 Sequence: AAATGAGAATGATTAATGTTA Position: -2 Score: 4.8 Sequence: TAATGAAAATTAAATTGATTT Locus tag: PE36_19080 Name: fhuB Funciton: ABC transporter ATP-binding protein YojI
	PE36_19080	fhuB	ABC transporter ATP-binding protein YojI
Position: -58 Score: 5.3 Sequence: TAATGATAACCATTCTTAATC Locus tag: PE36_14229 Name: null Funciton: hypothetical protein
	PE36_14229		hypothetical protein
Position: -58 Score: 5.4 Sequence: TAATACGAACCATTCTCATTA Locus tag: PE36_14199 Name: null Funciton: hypothetical protein Locus tag: PE36_14204 Name: null Funciton: hypothetical protein
	PE36_14199		hypothetical protein
	PE36_14204		hypothetical protein
Position: -94 Score: 6.2 Sequence: TAATGAAAATTGTTATCATTT Locus tag: PE36_02327 Name: PE36_02327 Funciton: Ferric siderophore receptor-like protein, TonB-dependent Locus tag: PE36_02322 Name: fecF Funciton: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein Locus tag: PE36_02317 Name: fecD Funciton: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) Locus tag: PE36_02312 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) Locus tag: PE36_02307 Name: PE36_02307 Funciton: TonB system biopolymer transport component; Chromosome segregation ATPase Locus tag: PE36_02302 Name: AHA_4251 Funciton: TonB system biopolymer transport component Locus tag: PE36_02297 Name: exbB2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbB Locus tag: PE36_02292 Name: exbD2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbD Locus tag: PE36_02287 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: PE36_02282 Name: PE36_02282 Funciton: TPR domain protein, putative component of TonB system
	PE36_02327	PE36_02327	Ferric siderophore receptor-like protein, TonB-dependent
	PE36_02322	fecF	Iron(III) dicitrate transport system periplasmic substrate-binding transport protein
	PE36_02317	fecD	Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
	PE36_02312	fecE	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	PE36_02307	PE36_02307	TonB system biopolymer transport component; Chromosome segregation ATPase
	PE36_02302	AHA_4251	TonB system biopolymer transport component
	PE36_02297	exbB2	Ferric siderophore transport system, biopolymer transport protein ExbB
	PE36_02292	exbD2	Ferric siderophore transport system, biopolymer transport protein ExbD
	PE36_02287	tonB2	Ferric siderophore transport system, periplasmic binding protein TonB
	PE36_02282	PE36_02282	TPR domain protein, putative component of TonB system
Position: -197 Score: 4.5 Sequence: TAAAGATTATCTTTTTCATTT Position: -85 Score: 5.7 Sequence: AATTGCGAATAGTTTTCATTT Locus tag: PE36_10008 Name: null Funciton: hypothetical protein
	PE36_10008		hypothetical protein
Position: -106 Score: 4.9 Sequence: TAAATACAATGATTCTCATTT Locus tag: PE36_07037 Name: PCNPT3_00166 Funciton: TonB system biopolymer transport component Locus tag: PE36_07032 Name: PCNPT3_00171 Funciton: MotA/TolQ/ExbB proton channel family protein Locus tag: PE36_07027 Name: exbB2 Funciton: Biopolymer transport protein ExbB Locus tag: PE36_07022 Name: exbD2 Funciton: Biopolymer transport protein ExbD Locus tag: PE36_07017 Name: tonB2 Funciton: TonB protein Locus tag: PE36_07012 Name: PCNPT3_00191 Funciton: TPR domain protein, putative component of TonB system
	PE36_07037	PCNPT3_00166	TonB system biopolymer transport component
	PE36_07032	PCNPT3_00171	MotA/TolQ/ExbB proton channel family protein
	PE36_07027	exbB2	Biopolymer transport protein ExbB
	PE36_07022	exbD2	Biopolymer transport protein ExbD
	PE36_07017	tonB2	TonB protein
	PE36_07012	PCNPT3_00191	TPR domain protein, putative component of TonB system
Position: -139 Score: 5.4 Sequence: TTATGATAATAATTTTTATCT Locus tag: PE36_08636 Name: null Funciton: hypothetical outer membrane protein
	PE36_08636		hypothetical outer membrane protein
Position: -35 Score: 5.5 Sequence: TAATACGAACAATTATCATTT Locus tag: PE36_17585 Name: PE36_17585 Funciton: Ferric anguibactin-binding protein Locus tag: PE36_17590 Name: PE36_17590 Funciton: catechol siderophore ABC transporter, permease protein Locus tag: PE36_17595 Name: PE36_17595 Funciton: ferric anguibactin transport system permease protein FatC Locus tag: PE36_17600 Name: PE36_17600 Funciton: ferric anguibactin transport ATP-binding protein Locus tag: PE36_17605 Name: null Funciton: vulnibactin utilization protein ViuB
	PE36_17585	PE36_17585	Ferric anguibactin-binding protein
	PE36_17590	PE36_17590	catechol siderophore ABC transporter, permease protein
	PE36_17595	PE36_17595	ferric anguibactin transport system permease protein FatC
	PE36_17600	PE36_17600	ferric anguibactin transport ATP-binding protein
	PE36_17605		vulnibactin utilization protein ViuB
Position: -102 Score: 6 Sequence: TTATGAGAATTATTATCATTT Locus tag: PE36_07672 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PE36_07667 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PE36_07662 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	PE36_07672	fbpA	Ferric iron ABC transporter, iron-binding protein
	PE36_07667	fbpB	Ferric iron ABC transporter, permease protein
	PE36_07662	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -80 Score: 5.7 Sequence: TAATGATAATAATTATTATTC Position: -57 Score: 4.8 Sequence: CAATGCAAATAACTATCATTA Locus tag: PE36_01255 Name: irpA Funciton: Iron-regulated protein A precursor
	PE36_01255	irpA	Iron-regulated protein A precursor
Position: -79 Score: 5.7 Sequence: AAATGAGAATTATTCTTATAA Locus tag: PE36_09918 Name: PE36_09918 Funciton: Transcriptional regulator, AraC family
	PE36_09918	PE36_09918	Transcriptional regulator, AraC family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Moritella sp. PE36

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --