Orthologous regulated operons containing hemY gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -105 Score: 4.77445 Sequence: TAATAAAAATCATTTTCAGCG Locus tag: AHA_0469 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: AHA_0468 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: AHA_0467 Name: hemX Funciton: uroporphyrin-III C-methyltransferase HemX Locus tag: AHA_0466 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-105	4.8	TAATAAAAATCATTTTCAGCG	AHA_0469
Aeromonas salmonicida subsp. salmonicida A449
Position: -105 Score: 5.39232 Sequence: TAATGAAAATCATTTTCAGCA Locus tag: ASA_3875 Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61) Locus tag: ASA_3876 Name: hemD Funciton: Uroporphyrinogen-III synthase (EC 4.2.1.75) Locus tag: ASA_3877 Name: hemX Funciton: uroporphyrin-III C-methyltransferase HemX Locus tag: ASA_3878 Name: hemY Funciton: HemY protein
hemC-hemD-hemX-hemY	-105	5.4	TAATGAAAATCATTTTCAGCA	ASA_3875

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --