Regulog Zur - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	7	5
Salmonella typhimurium LT2	7	5
Citrobacter koseri ATCC BAA-895	26	11
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	9	5
Enterobacter sp. 638	9	5
Erwinia amylovora ATCC 49946	5	3
Yersinia pestis KIM	6	4
Serratia proteamaculans 568	20	9
Erwinia carotovora subsp. atroseptica SCRI1043	13	6
Edwardsiella tarda EIB202	4	3
Proteus mirabilis HI4320	9	5
Photorhabdus luminescens subsp. laumondii TTO1	5	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
dksA2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -49 score = 6.16125 sequence = TTAATGTTATGTTATAACGTTTC Gene: CKO_00932: DnaK suppressor protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -43 score = 6.4596 sequence = GATATGTTATAATATAACAATTA Gene: Spro_1939: DnaK suppressor protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	DnaK suppressor protein
yciA	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00933: protein of unknown function DUF198	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -69 score = 5.82403 sequence = GATATGTTATAACATAACAAAAT Gene: Spro_2628: protein of unknown function DUF198	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	protein of unknown function DUF198
can2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00934: carbonic anhydrase	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_2627: carbonic anhydrase	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	carbonic anhydrase
yciC	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00925: Putative zinc chaperone, COG0523 family	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_2626: Putative zinc chaperone, COG0523 family	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Putative zinc chaperone, COG0523 family
hisI2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	2 Citrobacter koseri ATCC BAA-895* Site: position = -25 score = 5.61005 sequence = TTATTGTTACGTTATAACATAAC Gene: CKO_00923: phosphoribosyl-AMP cyclohydrolase Gene: CKO_00924: phosphoribosyl-AMP cyclohydrolase	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	phosphoribosyl-AMP cyclohydrolase

CRON 2.
znuC	* Escherichia coli str. K-12 substr. MG1655 Site: position = -49 score = 6.53237 sequence = GAAGTGTGATATTATAACATTTC Gene: b1858: high-affinity zinc ABC transporter, ATP-binding protein	* Salmonella typhimurium LT2 Site: position = -49 score = 6.65424 sequence = GAAATGTGATATTATAACATTCT Gene: STM1892.S: high-affinity zinc ABC transporter, ATP-binding protein	* Citrobacter koseri ATCC BAA-895 Site: position = -49 score = 6.65424 sequence = GAAATGTGATATTATAACATTCT Gene: CKO_01105: high-affinity zinc ABC transporter, ATP-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -49 score = 6.35496 sequence = GTGATGTGATATTATAACATTCA Gene: KPN_02373: high-affinity zinc ABC transporter, ATP-binding protein	* Enterobacter sp. 638 Site: position = -48 score = 6.19447 sequence = TGGATGTGATATTATAACATTCG Gene: Ent638_2427: high-affinity zinc ABC transporter, ATP-binding protein	* Erwinia amylovora ATCC 49946 Site: position = -48 score = 6.0646 sequence = ATTTTGTGATATTATAACATTTG Gene: EAM_2001: high-affinity zinc ABC transporter, ATP-binding protein	* Yersinia pestis KIM Site: position = -47 score = 5.65265 sequence = AAAGCGTAATATTATAACATTCA Gene: y2250: high-affinity zinc ABC transporter, ATP-binding protein	* Serratia proteamaculans 568 Site: position = -50 score = 5.81505 sequence = GAGGCGTGATATTATAACATTCG Gene: Spro_2774: high-affinity zinc ABC transporter, ATP-binding protein	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -46 score = 6.4252 sequence = TGTTTGTTATATTATAACATTAC Gene: ECA2485: high-affinity zinc ABC transporter, ATP-binding protein	* Edwardsiella tarda EIB202 Site: position = -72 score = 6.72066 sequence = GAAACGTTATATTATAACATTCC Gene: ETAE_1442: high-affinity zinc ABC transporter, ATP-binding protein	* Proteus mirabilis HI4320 Site: position = -47 score = 6.73178 sequence = GAAATGTTATATTATAACGTTTC Gene: PMI1151: high-affinity zinc ABC transporter, ATP-binding protein	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -48 score = 6.63204 sequence = GAATTGTTATATTATAACATCTC Gene: plu2114: high-affinity zinc ABC transporter, ATP-binding protein	high-affinity zinc ABC transporter, ATP-binding protein
znuB	Escherichia coli str. K-12 substr. MG1655 Gene: b1859: high-affinity zinc ABC transporter, membrane component	Salmonella typhimurium LT2 Gene: STM1893: high-affinity zinc ABC transporter, membrane component	Citrobacter koseri ATCC BAA-895 Gene: CKO_01104: high-affinity zinc ABC transporter, membrane component	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02374: high-affinity zinc ABC transporter, membrane component	Enterobacter sp. 638 Gene: Ent638_2428: high-affinity zinc ABC transporter, membrane component	Erwinia amylovora ATCC 49946 Gene: EAM_2002: high-affinity zinc ABC transporter, membrane component	Yersinia pestis KIM Gene: y2251: high-affinity zinc ABC transporter, membrane component	Serratia proteamaculans 568 Gene: Spro_2775: high-affinity zinc ABC transporter, membrane component	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2486: high-affinity zinc ABC transporter, membrane component	Edwardsiella tarda EIB202 Gene: ETAE_1441: high-affinity zinc ABC transporter, membrane component	Proteus mirabilis HI4320 Gene: PMI1150: high-affinity zinc ABC transporter, membrane component	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2113: high-affinity zinc ABC transporter, membrane component	high-affinity zinc ABC transporter, membrane component

CRON 3.
znuA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -52 score = 6.4917 sequence = GAAATGTTATAATATCACACTTC Gene: b1857: high-affinity zinc ABC transporter, substrate-binding protein	* Salmonella typhimurium LT2 Site: position = -52 score = 6.55198 sequence = AGAATGTTATAATATCACATTTC Gene: STM1891: high-affinity zinc ABC transporter, substrate-binding protein	* Citrobacter koseri ATCC BAA-895 Site: position = -37 score = 6.55198 sequence = AGAATGTTATAATATCACATTTC Gene: CKO_01106: high-affinity zinc ABC transporter, substrate-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -100 score = 6.27209 sequence = TGAATGTTATAATATCACATCAC Gene: KPN_02372: high-affinity zinc ABC transporter, substrate-binding protein	* Enterobacter sp. 638 Site: position = -52 score = 6.05256 sequence = CGAATGTTATAATATCACATCCA Gene: Ent638_2426: high-affinity zinc ABC transporter, substrate-binding protein	* Erwinia amylovora ATCC 49946 Site: position = -52 score = 5.9459 sequence = CAAATGTTATAATATCACAAAAT Gene: EAM_2000: high-affinity zinc ABC transporter, substrate-binding protein	* Yersinia pestis KIM Site: position = -51 score = 5.62491 sequence = TGAATGTTATAATATTACGCTTT Gene: y2249: high-affinity zinc ABC transporter, substrate-binding protein	* Serratia proteamaculans 568 Site: position = -51 score = 5.6748 sequence = CGAATGTTATAATATCACGCCTC Gene: Spro_2773: high-affinity zinc ABC transporter, substrate-binding protein	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -53 score = 6.3122 sequence = GTAATGTTATAATATAACAAACA Gene: ECA2484: high-affinity zinc ABC transporter, substrate-binding protein	* Edwardsiella tarda EIB202 Site: position = -50 score = 6.61406 sequence = GGAATGTTATAATATAACGTTTC Gene: ETAE_1443: high-affinity zinc ABC transporter, substrate-binding protein	* Proteus mirabilis HI4320 Site: position = -50 score = 6.70671 sequence = GAAACGTTATAATATAACATTTC Gene: PMI1152: high-affinity zinc ABC transporter, substrate-binding protein	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -51 score = 6.61626 sequence = GAGATGTTATAATATAACAATTC Gene: plu2115: high-affinity zinc ABC transporter, substrate-binding protein	high-affinity zinc ABC transporter, substrate-binding protein

CRON 4.
rpmE2	* Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 5.62892 sequence = TTATGGTTATGTTATAACATAAC Gene: b0296: 50S ribosomal protein L31 paralog	* Salmonella typhimurium LT2 Site: position = -35 score = 5.84495 sequence = TTATTGTTATGTTATAACATAAT Gene: STM0469: 50S ribosomal protein L31 paralog	* Citrobacter koseri ATCC BAA-895 Site: position = -35 score = 5.45919 sequence = TTATTGTTACGTTATAACATAAT Gene: CKO_02696: 50S ribosomal protein L31 paralog	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 5.54967 sequence = TTATTGTTATGTTATAACGTAAT Gene: KPN_00435: 50S ribosomal protein L31 paralog	* Enterobacter sp. 638 Site: position = -37 score = 5.56672 sequence = CTTTTGTTATGTTATAACAAAAC Gene: Ent638_0934: 50S ribosomal protein L31 paralog	* Erwinia amylovora ATCC 49946 Site: position = -36 score = 5.95811 sequence = TTTTGGTTATATTATAACATATC Gene: EAM_1015: 50S ribosomal protein L31 paralog	* Yersinia pestis KIM Site: position = -36 score = 5.85423 sequence = ATGATGTTACATTATAACATACT Gene: y1048: 50S ribosomal protein L31 paralog	* Serratia proteamaculans 568 Site: position = -36 score = 6.22245 sequence = TTATTGTTATAGTATAACATTAC Gene: Spro_1125: 50S ribosomal protein L31 paralog	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -31 score = 6.04505 sequence = GATATGTTATAACATAACAATTG Gene: ECA1168: 50S ribosomal protein L31 paralog	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -38 score = 6.5472 sequence = ATATTGTTATATTATAACATTAC Gene: PMI3379: 50S ribosomal protein L31 paralog	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -32 score = 6.19613 sequence = GTAATGTTATATTATTACAATTT Gene: plu0036: 50S ribosomal protein L31 paralog	50S ribosomal protein L31 paralog
rpmJ2	Escherichia coli str. K-12 substr. MG1655 Gene: b4506: 50S ribosomal protein L36 paralog	Salmonella typhimurium LT2 Gene: STM0470: 50S ribosomal protein L36 paralog	Citrobacter koseri ATCC BAA-895 Gene: CKO_02695: 50S ribosomal protein L36 paralog	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00436: 50S ribosomal protein L36 paralog	Enterobacter sp. 638 Gene: Ent638_0935: 50S ribosomal protein L36 paralog	Erwinia amylovora ATCC 49946 Gene: EAM_1014: 50S ribosomal protein L36 paralog	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1124: 50S ribosomal protein L36 paralog	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA1167: 50S ribosomal protein L36 paralog	* Edwardsiella tarda EIB202 Site: position = -148 score = 5.94284 sequence = GTATTGTTATAACATAACATATG Gene: ETAE_1964: 50S ribosomal protein L36 paralog	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu0035: 50S ribosomal protein L36 paralog	50S ribosomal protein L36 paralog
zinT	* Escherichia coli str. K-12 substr. MG1655 Site: position = -56 score = 6.2532 sequence = TATATGTTACAATATAACATTAC Gene: b1973: zinc-binding protein	* Salmonella typhimurium LT2 Site: position = -54 score = 6.24642 sequence = GCAATGTTATAATATAACAATCA Gene: STM1263: zinc-binding protein	* Citrobacter koseri ATCC BAA-895 Site: position = -91 score = 6.7522 sequence = GTGATGTTATATTATAACATTCC Gene: CKO_01827: zinc-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -55 score = 5.6982 sequence = GATATGTTATATCGTAACAATTT Gene: KPN_04244: zinc-binding protein	* Enterobacter sp. 638 Site: position = -53 score = 6.11521 sequence = GATATGTTATACTATAACATCCT Gene: Ent638_1993: zinc-binding protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI3380: zinc-binding protein	Photorhabdus luminescens subsp. laumondii TTO1	zinc-binding protein

CRON 5.
znuC2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	2 Citrobacter koseri ATCC BAA-895* Site: position = -141 score = 6.14003 sequence = TTATTGTTATGTTATAACATTTT Gene: CKO_04054: putative zinc ABC transporter, ATP-binding protein Site: position = -45 score = 5.73455 sequence = CATTTGTTATGTTATAACGTTAC Gene: CKO_00951: putative zinc ABC transporter, ATP-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -108 score = 6.00479 sequence = TTATTGTTATGTTATAACATTAA Gene: KPN_03035: putative zinc ABC transporter, ATP-binding protein	* Enterobacter sp. 638 Site: position = -140 score = 5.92211 sequence = TTAGTGTTATGTTATAACATTAT Gene: Ent638_3178: putative zinc ABC transporter, ATP-binding protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -185 score = 5.78697 sequence = GTGATGTTATAATGTAACACTTA Gene: Spro_1121: putative zinc ABC transporter, ATP-binding protein	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -123 score = 6.4596 sequence = GATATGTTATAATATAACAATTA Gene: ECA3756: putative zinc ABC transporter, ATP-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	putative zinc ABC transporter, ATP-binding protein
znuB2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	2 Citrobacter koseri ATCC BAA-895 Gene: CKO_04053: putative zinc ABC transporter, membrane protein Gene: CKO_00950: putative zinc ABC transporter, membrane protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03034: putative zinc ABC transporter, membrane protein	Enterobacter sp. 638 Gene: Ent638_3177: putative zinc ABC transporter, membrane protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1122: putative zinc ABC transporter, membrane protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3757: putative zinc ABC transporter, membrane protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	putative zinc ABC transporter, membrane protein
znuA2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	2 Citrobacter koseri ATCC BAA-895 Gene: CKO_04052: putative zinc ABC transporter, substrate-binding protein Gene: CKO_00949: putative zinc ABC transporter, substrate-binding protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03033: putative zinc ABC transporter, substrate-binding protein	Enterobacter sp. 638 Gene: Ent638_3176: putative zinc ABC transporter, substrate-binding protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1123: putative zinc ABC transporter, substrate-binding protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3758: putative zinc ABC transporter, substrate-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	putative zinc ABC transporter, substrate-binding protein

CRON 6.
omr1	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -45 score = 6.28965 sequence = GATATGTTATGTTATAACATATC Gene: CKO_00835: predicted zinc-related TonB-dependent outer membrane transporter	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -85 score = 5.9958 sequence = TTATTGTTATGTTATAACATAAC Site: position = -80 score = 5.71076 sequence = GTTATGTTATAACATAACAAAAA Gene: Spro_1297: predicted zinc-related TonB-dependent outer membrane transporter	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related TonB-dependent outer membrane transporter
znuX	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00834: predicted zinc-related ABC transporter, periplasmic binding protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1298: predicted zinc-related ABC transporter, periplasmic binding protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related ABC transporter, periplasmic binding protein
znuW	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00833: predicted zinc-related methyltransferase type 12	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1299: predicted zinc-related methyltransferase type 12	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related methyltransferase type 12
znuY	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00832: predicted zinc-related ABC transporter, permease protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1300: predicted zinc-related ABC transporter, permease protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related ABC transporter, permease protein
znuZ	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_1301: predicted zinc-related ABC transporter, ATP-binding protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related ABC transporter, ATP-binding protein

CRON 7.
pliG	* Escherichia coli str. K-12 substr. MG1655 Site: position = -53 score = 6.25168 sequence = GGATTGTTATATTATAACAGTTC Gene: b1178: periplasmic lysozme inhibitor of g-type lysozyme	* Salmonella typhimurium LT2 Site: position = -54 score = 5.86998 sequence = TTATTGTTACAATATAACAATTA Gene: STM2610: periplasmic lysozme inhibitor of g-type lysozyme	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	periplasmic lysozme inhibitor of g-type lysozyme

CRON 8.
ECA3248	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM2552: ABC-type uncharacterized transport system, periplasmic component	Citrobacter koseri ATCC BAA-895 Gene: CKO_00246: ABC-type uncharacterized transport system, periplasmic component	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02868: ABC-type uncharacterized transport system, periplasmic component	Enterobacter sp. 638 Gene: Ent638_3032: ABC-type uncharacterized transport system, periplasmic component	Erwinia amylovora ATCC 49946	* Yersinia pestis KIM Site: position = 6 score = 5.11145 sequence = TATGTGTTACATTATAACGGTTT Gene: y1329: ABC-type uncharacterized transport system, periplasmic component	* Serratia proteamaculans 568 Site: position = -3 score = 5.26669 sequence = TTTATGTTACTTTATAACAATAA Gene: Spro_3632: ABC-type uncharacterized transport system, periplasmic component	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -3 score = 5.67147 sequence = ATAATGTTACATTATAACGCTTT Gene: ECA3248: ABC-type uncharacterized transport system, periplasmic component	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -42 score = 6.13711 sequence = GTGATGTTATATTATAACAAAAT Gene: PMI1519: ABC-type uncharacterized transport system, periplasmic component	Photorhabdus luminescens subsp. laumondii TTO1	ABC-type uncharacterized transport system, periplasmic component
ECA3247	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM2551: ABC-type uncharacterized transport system, permease component	Citrobacter koseri ATCC BAA-895 Gene: CKO_00247: ABC-type uncharacterized transport system, permease component	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02867: ABC-type uncharacterized transport system, permease component	Enterobacter sp. 638 Gene: Ent638_3031: ABC-type uncharacterized transport system, permease component	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1330: ABC-type uncharacterized transport system, permease component	Serratia proteamaculans 568 Gene: Spro_3631: ABC-type uncharacterized transport system, permease component	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3247: ABC-type uncharacterized transport system, permease component	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1518: ABC-type uncharacterized transport system, permease component	Photorhabdus luminescens subsp. laumondii TTO1	ABC-type uncharacterized transport system, permease component

CRON 9.
ECA4254	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -29 score = 6.11899 sequence = TAATTGTTATGATATAACATATC Gene: CKO_00850: predicted zinc-regulated ABC transporter, ATP-binding protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -55 score = 5.37109 sequence = AATTTGGTATGTTATAACATACC Gene: ECA4254: predicted zinc-regulated ABC transporter, ATP-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-regulated ABC transporter, ATP-binding protein
ECA4255	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00851: predicted zinc-regulated ABC transporter, periplasmic-binding protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA4255: predicted zinc-regulated ABC transporter, periplasmic-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-regulated ABC transporter, periplasmic-binding protein
ECA4256	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_00852: predicted zinc-regulated ABC transporter, permease protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA4256: predicted zinc-regulated ABC transporter, permease protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-regulated ABC transporter, permease protein

CRON 10.
CKO_00947	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -111 score = 5.79897 sequence = GTTATGTTATTTTATAACATCCA Gene: CKO_00947: hypothetical protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -47 score = 5.37908 sequence = GAGATGTTTTGTTATAACGTATC Gene: Spro_3158: hypothetical protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	hypothetical protein

CRON 11.
omr2	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -23 score = 5.77877 sequence = GATATGTTATAACATAACAAAAA Gene: PMI2619: predicted zinc-related TonB-dependent outer membrane transporter	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related TonB-dependent outer membrane transporter
omr3	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI2618: predicted zinc-related TonB-dependent outer membrane transporter	Photorhabdus luminescens subsp. laumondii TTO1	predicted zinc-related TonB-dependent outer membrane transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --