Regulog Zur - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 7 | 5 |
| Salmonella typhimurium LT2 | 7 | 5 |
| Citrobacter koseri ATCC BAA-895 | 26 | 11 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 9 | 5 |
| Enterobacter sp. 638 | 9 | 5 |
| Erwinia amylovora ATCC 49946 | 5 | 3 |
| Yersinia pestis KIM | 6 | 4 |
| Serratia proteamaculans 568 | 20 | 9 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 13 | 6 |
| Edwardsiella tarda EIB202 | 4 | 3 |
| Proteus mirabilis HI4320 | 9 | 5 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 5 | 3 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| dksA2 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -49 score = 6.16125 sequence = TTAATGTTATGTTATAACGTTTC Gene: CKO_00932: DnaK suppressor protein |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -43 score = 6.4596 sequence = GATATGTTATAATATAACAATTA Gene: Spro_1939: DnaK suppressor protein |
|
|
|
|
DnaK suppressor protein |
| yciA |
|
|
Gene: CKO_00933: protein of unknown function DUF198 |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -69 score = 5.82403 sequence = GATATGTTATAACATAACAAAAT Gene: Spro_2628: protein of unknown function DUF198 |
|
|
|
|
protein of unknown function DUF198 |
| can2 |
|
|
Gene: CKO_00934: carbonic anhydrase |
|
|
|
|
Gene: Spro_2627: carbonic anhydrase |
|
|
|
|
carbonic anhydrase |
| yciC |
|
|
Gene: CKO_00925: Putative zinc chaperone, COG0523 family |
|
|
|
|
Gene: Spro_2626: Putative zinc chaperone, COG0523 family |
|
|
|
|
Putative zinc chaperone, COG0523 family |
| hisI2 |
|
|
*2
Citrobacter koseri ATCC BAA-895 Site: position = -25 score = 5.61005 sequence = TTATTGTTACGTTATAACATAAC Gene: CKO_00923: phosphoribosyl-AMP cyclohydrolase Gene: CKO_00924: phosphoribosyl-AMP cyclohydrolase |
|
|
|
|
|
|
|
|
|
phosphoribosyl-AMP cyclohydrolase |
| CRON 2. | |||||||||||||
| znuC |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -49 score = 6.53237 sequence = GAAGTGTGATATTATAACATTTC Gene: b1858: high-affinity zinc ABC transporter, ATP-binding protein |
*
Salmonella typhimurium LT2 Site: position = -49 score = 6.65424 sequence = GAAATGTGATATTATAACATTCT Gene: STM1892.S: high-affinity zinc ABC transporter, ATP-binding protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -49 score = 6.65424 sequence = GAAATGTGATATTATAACATTCT Gene: CKO_01105: high-affinity zinc ABC transporter, ATP-binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -49 score = 6.35496 sequence = GTGATGTGATATTATAACATTCA Gene: KPN_02373: high-affinity zinc ABC transporter, ATP-binding protein |
*
Enterobacter sp. 638 Site: position = -48 score = 6.19447 sequence = TGGATGTGATATTATAACATTCG Gene: Ent638_2427: high-affinity zinc ABC transporter, ATP-binding protein |
*
Erwinia amylovora ATCC 49946 Site: position = -48 score = 6.0646 sequence = ATTTTGTGATATTATAACATTTG Gene: EAM_2001: high-affinity zinc ABC transporter, ATP-binding protein |
*
Yersinia pestis KIM Site: position = -47 score = 5.65265 sequence = AAAGCGTAATATTATAACATTCA Gene: y2250: high-affinity zinc ABC transporter, ATP-binding protein |
*
Serratia proteamaculans 568 Site: position = -50 score = 5.81505 sequence = GAGGCGTGATATTATAACATTCG Gene: Spro_2774: high-affinity zinc ABC transporter, ATP-binding protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -46 score = 6.4252 sequence = TGTTTGTTATATTATAACATTAC Gene: ECA2485: high-affinity zinc ABC transporter, ATP-binding protein |
*
Edwardsiella tarda EIB202 Site: position = -72 score = 6.72066 sequence = GAAACGTTATATTATAACATTCC Gene: ETAE_1442: high-affinity zinc ABC transporter, ATP-binding protein |
*
Proteus mirabilis HI4320 Site: position = -47 score = 6.73178 sequence = GAAATGTTATATTATAACGTTTC Gene: PMI1151: high-affinity zinc ABC transporter, ATP-binding protein |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -48 score = 6.63204 sequence = GAATTGTTATATTATAACATCTC Gene: plu2114: high-affinity zinc ABC transporter, ATP-binding protein |
high-affinity zinc ABC transporter, ATP-binding protein |
| znuB |
Gene: b1859: high-affinity zinc ABC transporter, membrane component |
Gene: STM1893: high-affinity zinc ABC transporter, membrane component |
Gene: CKO_01104: high-affinity zinc ABC transporter, membrane component |
Gene: KPN_02374: high-affinity zinc ABC transporter, membrane component |
Gene: Ent638_2428: high-affinity zinc ABC transporter, membrane component |
Gene: EAM_2002: high-affinity zinc ABC transporter, membrane component |
Gene: y2251: high-affinity zinc ABC transporter, membrane component |
Gene: Spro_2775: high-affinity zinc ABC transporter, membrane component |
Gene: ECA2486: high-affinity zinc ABC transporter, membrane component |
Gene: ETAE_1441: high-affinity zinc ABC transporter, membrane component |
Gene: PMI1150: high-affinity zinc ABC transporter, membrane component |
Gene: plu2113: high-affinity zinc ABC transporter, membrane component |
high-affinity zinc ABC transporter, membrane component |
| CRON 3. | |||||||||||||
| znuA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -52 score = 6.4917 sequence = GAAATGTTATAATATCACACTTC Gene: b1857: high-affinity zinc ABC transporter, substrate-binding protein |
*
Salmonella typhimurium LT2 Site: position = -52 score = 6.55198 sequence = AGAATGTTATAATATCACATTTC Gene: STM1891: high-affinity zinc ABC transporter, substrate-binding protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -37 score = 6.55198 sequence = AGAATGTTATAATATCACATTTC Gene: CKO_01106: high-affinity zinc ABC transporter, substrate-binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -100 score = 6.27209 sequence = TGAATGTTATAATATCACATCAC Gene: KPN_02372: high-affinity zinc ABC transporter, substrate-binding protein |
*
Enterobacter sp. 638 Site: position = -52 score = 6.05256 sequence = CGAATGTTATAATATCACATCCA Gene: Ent638_2426: high-affinity zinc ABC transporter, substrate-binding protein |
*
Erwinia amylovora ATCC 49946 Site: position = -52 score = 5.9459 sequence = CAAATGTTATAATATCACAAAAT Gene: EAM_2000: high-affinity zinc ABC transporter, substrate-binding protein |
*
Yersinia pestis KIM Site: position = -51 score = 5.62491 sequence = TGAATGTTATAATATTACGCTTT Gene: y2249: high-affinity zinc ABC transporter, substrate-binding protein |
*
Serratia proteamaculans 568 Site: position = -51 score = 5.6748 sequence = CGAATGTTATAATATCACGCCTC Gene: Spro_2773: high-affinity zinc ABC transporter, substrate-binding protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -53 score = 6.3122 sequence = GTAATGTTATAATATAACAAACA Gene: ECA2484: high-affinity zinc ABC transporter, substrate-binding protein |
*
Edwardsiella tarda EIB202 Site: position = -50 score = 6.61406 sequence = GGAATGTTATAATATAACGTTTC Gene: ETAE_1443: high-affinity zinc ABC transporter, substrate-binding protein |
*
Proteus mirabilis HI4320 Site: position = -50 score = 6.70671 sequence = GAAACGTTATAATATAACATTTC Gene: PMI1152: high-affinity zinc ABC transporter, substrate-binding protein |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -51 score = 6.61626 sequence = GAGATGTTATAATATAACAATTC Gene: plu2115: high-affinity zinc ABC transporter, substrate-binding protein |
high-affinity zinc ABC transporter, substrate-binding protein |
| CRON 4. | |||||||||||||
| rpmE2 |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 5.62892 sequence = TTATGGTTATGTTATAACATAAC Gene: b0296: 50S ribosomal protein L31 paralog |
*
Salmonella typhimurium LT2 Site: position = -35 score = 5.84495 sequence = TTATTGTTATGTTATAACATAAT Gene: STM0469: 50S ribosomal protein L31 paralog |
*
Citrobacter koseri ATCC BAA-895 Site: position = -35 score = 5.45919 sequence = TTATTGTTACGTTATAACATAAT Gene: CKO_02696: 50S ribosomal protein L31 paralog |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 5.54967 sequence = TTATTGTTATGTTATAACGTAAT Gene: KPN_00435: 50S ribosomal protein L31 paralog |
*
Enterobacter sp. 638 Site: position = -37 score = 5.56672 sequence = CTTTTGTTATGTTATAACAAAAC Gene: Ent638_0934: 50S ribosomal protein L31 paralog |
*
Erwinia amylovora ATCC 49946 Site: position = -36 score = 5.95811 sequence = TTTTGGTTATATTATAACATATC Gene: EAM_1015: 50S ribosomal protein L31 paralog |
*
Yersinia pestis KIM Site: position = -36 score = 5.85423 sequence = ATGATGTTACATTATAACATACT Gene: y1048: 50S ribosomal protein L31 paralog |
*
Serratia proteamaculans 568 Site: position = -36 score = 6.22245 sequence = TTATTGTTATAGTATAACATTAC Gene: Spro_1125: 50S ribosomal protein L31 paralog |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -31 score = 6.04505 sequence = GATATGTTATAACATAACAATTG Gene: ECA1168: 50S ribosomal protein L31 paralog |
|
*
Proteus mirabilis HI4320 Site: position = -38 score = 6.5472 sequence = ATATTGTTATATTATAACATTAC Gene: PMI3379: 50S ribosomal protein L31 paralog |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -32 score = 6.19613 sequence = GTAATGTTATATTATTACAATTT Gene: plu0036: 50S ribosomal protein L31 paralog |
50S ribosomal protein L31 paralog |
| rpmJ2 |
Gene: b4506: 50S ribosomal protein L36 paralog |
Gene: STM0470: 50S ribosomal protein L36 paralog |
Gene: CKO_02695: 50S ribosomal protein L36 paralog |
Gene: KPN_00436: 50S ribosomal protein L36 paralog |
Gene: Ent638_0935: 50S ribosomal protein L36 paralog |
Gene: EAM_1014: 50S ribosomal protein L36 paralog |
|
Gene: Spro_1124: 50S ribosomal protein L36 paralog |
Gene: ECA1167: 50S ribosomal protein L36 paralog |
*
Edwardsiella tarda EIB202 Site: position = -148 score = 5.94284 sequence = GTATTGTTATAACATAACATATG Gene: ETAE_1964: 50S ribosomal protein L36 paralog |
|
Gene: plu0035: 50S ribosomal protein L36 paralog |
50S ribosomal protein L36 paralog |
| zinT |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -56 score = 6.2532 sequence = TATATGTTACAATATAACATTAC Gene: b1973: zinc-binding protein |
*
Salmonella typhimurium LT2 Site: position = -54 score = 6.24642 sequence = GCAATGTTATAATATAACAATCA Gene: STM1263: zinc-binding protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -91 score = 6.7522 sequence = GTGATGTTATATTATAACATTCC Gene: CKO_01827: zinc-binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -55 score = 5.6982 sequence = GATATGTTATATCGTAACAATTT Gene: KPN_04244: zinc-binding protein |
*
Enterobacter sp. 638 Site: position = -53 score = 6.11521 sequence = GATATGTTATACTATAACATCCT Gene: Ent638_1993: zinc-binding protein |
|
|
|
|
|
Gene: PMI3380: zinc-binding protein |
|
zinc-binding protein |
| CRON 5. | |||||||||||||
| znuC2 |
|
|
*2
Citrobacter koseri ATCC BAA-895 Site: position = -141 score = 6.14003 sequence = TTATTGTTATGTTATAACATTTT Gene: CKO_04054: putative zinc ABC transporter, ATP-binding protein Site: position = -45 score = 5.73455 sequence = CATTTGTTATGTTATAACGTTAC Gene: CKO_00951: putative zinc ABC transporter, ATP-binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -108 score = 6.00479 sequence = TTATTGTTATGTTATAACATTAA Gene: KPN_03035: putative zinc ABC transporter, ATP-binding protein |
*
Enterobacter sp. 638 Site: position = -140 score = 5.92211 sequence = TTAGTGTTATGTTATAACATTAT Gene: Ent638_3178: putative zinc ABC transporter, ATP-binding protein |
|
|
*
Serratia proteamaculans 568 Site: position = -185 score = 5.78697 sequence = GTGATGTTATAATGTAACACTTA Gene: Spro_1121: putative zinc ABC transporter, ATP-binding protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -123 score = 6.4596 sequence = GATATGTTATAATATAACAATTA Gene: ECA3756: putative zinc ABC transporter, ATP-binding protein |
|
|
|
putative zinc ABC transporter, ATP-binding protein |
| znuB2 |
|
|
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_04053: putative zinc ABC transporter, membrane protein Gene: CKO_00950: putative zinc ABC transporter, membrane protein |
Gene: KPN_03034: putative zinc ABC transporter, membrane protein |
Gene: Ent638_3177: putative zinc ABC transporter, membrane protein |
|
|
Gene: Spro_1122: putative zinc ABC transporter, membrane protein |
Gene: ECA3757: putative zinc ABC transporter, membrane protein |
|
|
|
putative zinc ABC transporter, membrane protein |
| znuA2 |
|
|
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_04052: putative zinc ABC transporter, substrate-binding protein Gene: CKO_00949: putative zinc ABC transporter, substrate-binding protein |
Gene: KPN_03033: putative zinc ABC transporter, substrate-binding protein |
Gene: Ent638_3176: putative zinc ABC transporter, substrate-binding protein |
|
|
Gene: Spro_1123: putative zinc ABC transporter, substrate-binding protein |
Gene: ECA3758: putative zinc ABC transporter, substrate-binding protein |
|
|
|
putative zinc ABC transporter, substrate-binding protein |
| CRON 6. | |||||||||||||
| omr1 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -45 score = 6.28965 sequence = GATATGTTATGTTATAACATATC Gene: CKO_00835: predicted zinc-related TonB-dependent outer membrane transporter |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -85 score = 5.9958 sequence = TTATTGTTATGTTATAACATAAC Site: position = -80 score = 5.71076 sequence = GTTATGTTATAACATAACAAAAA Gene: Spro_1297: predicted zinc-related TonB-dependent outer membrane transporter |
|
|
|
|
predicted zinc-related TonB-dependent outer membrane transporter |
| znuX |
|
|
Gene: CKO_00834: predicted zinc-related ABC transporter, periplasmic binding protein |
|
|
|
|
Gene: Spro_1298: predicted zinc-related ABC transporter, periplasmic binding protein |
|
|
|
|
predicted zinc-related ABC transporter, periplasmic binding protein |
| znuW |
|
|
Gene: CKO_00833: predicted zinc-related methyltransferase type 12 |
|
|
|
|
Gene: Spro_1299: predicted zinc-related methyltransferase type 12 |
|
|
|
|
predicted zinc-related methyltransferase type 12 |
| znuY |
|
|
Gene: CKO_00832: predicted zinc-related ABC transporter, permease protein |
|
|
|
|
Gene: Spro_1300: predicted zinc-related ABC transporter, permease protein |
|
|
|
|
predicted zinc-related ABC transporter, permease protein |
| znuZ |
|
|
|
|
|
|
|
Gene: Spro_1301: predicted zinc-related ABC transporter, ATP-binding protein |
|
|
|
|
predicted zinc-related ABC transporter, ATP-binding protein |
| CRON 7. | |||||||||||||
| pliG |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -53 score = 6.25168 sequence = GGATTGTTATATTATAACAGTTC Gene: b1178: periplasmic lysozme inhibitor of g-type lysozyme |
*
Salmonella typhimurium LT2 Site: position = -54 score = 5.86998 sequence = TTATTGTTACAATATAACAATTA Gene: STM2610: periplasmic lysozme inhibitor of g-type lysozyme |
|
|
|
|
|
|
|
|
|
|
periplasmic lysozme inhibitor of g-type lysozyme |
| CRON 8. | |||||||||||||
| ECA3248 |
|
Gene: STM2552: ABC-type uncharacterized transport system, periplasmic component |
Gene: CKO_00246: ABC-type uncharacterized transport system, periplasmic component |
Gene: KPN_02868: ABC-type uncharacterized transport system, periplasmic component |
Gene: Ent638_3032: ABC-type uncharacterized transport system, periplasmic component |
|
*
Yersinia pestis KIM Site: position = 6 score = 5.11145 sequence = TATGTGTTACATTATAACGGTTT Gene: y1329: ABC-type uncharacterized transport system, periplasmic component |
*
Serratia proteamaculans 568 Site: position = -3 score = 5.26669 sequence = TTTATGTTACTTTATAACAATAA Gene: Spro_3632: ABC-type uncharacterized transport system, periplasmic component |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -3 score = 5.67147 sequence = ATAATGTTACATTATAACGCTTT Gene: ECA3248: ABC-type uncharacterized transport system, periplasmic component |
|
*
Proteus mirabilis HI4320 Site: position = -42 score = 6.13711 sequence = GTGATGTTATATTATAACAAAAT Gene: PMI1519: ABC-type uncharacterized transport system, periplasmic component |
|
ABC-type uncharacterized transport system, periplasmic component |
| ECA3247 |
|
Gene: STM2551: ABC-type uncharacterized transport system, permease component |
Gene: CKO_00247: ABC-type uncharacterized transport system, permease component |
Gene: KPN_02867: ABC-type uncharacterized transport system, permease component |
Gene: Ent638_3031: ABC-type uncharacterized transport system, permease component |
|
Gene: y1330: ABC-type uncharacterized transport system, permease component |
Gene: Spro_3631: ABC-type uncharacterized transport system, permease component |
Gene: ECA3247: ABC-type uncharacterized transport system, permease component |
|
Gene: PMI1518: ABC-type uncharacterized transport system, permease component |
|
ABC-type uncharacterized transport system, permease component |
| CRON 9. | |||||||||||||
| ECA4254 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -29 score = 6.11899 sequence = TAATTGTTATGATATAACATATC Gene: CKO_00850: predicted zinc-regulated ABC transporter, ATP-binding protein |
|
|
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -55 score = 5.37109 sequence = AATTTGGTATGTTATAACATACC Gene: ECA4254: predicted zinc-regulated ABC transporter, ATP-binding protein |
|
|
|
predicted zinc-regulated ABC transporter, ATP-binding protein |
| ECA4255 |
|
|
Gene: CKO_00851: predicted zinc-regulated ABC transporter, periplasmic-binding protein |
|
|
|
|
|
Gene: ECA4255: predicted zinc-regulated ABC transporter, periplasmic-binding protein |
|
|
|
predicted zinc-regulated ABC transporter, periplasmic-binding protein |
| ECA4256 |
|
|
Gene: CKO_00852: predicted zinc-regulated ABC transporter, permease protein |
|
|
|
|
|
Gene: ECA4256: predicted zinc-regulated ABC transporter, permease protein |
|
|
|
predicted zinc-regulated ABC transporter, permease protein |
| CRON 10. | |||||||||||||
| CKO_00947 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -111 score = 5.79897 sequence = GTTATGTTATTTTATAACATCCA Gene: CKO_00947: hypothetical protein |
|
|
|
|
*
Serratia proteamaculans 568 Site: position = -47 score = 5.37908 sequence = GAGATGTTTTGTTATAACGTATC Gene: Spro_3158: hypothetical protein |
|
|
|
|
hypothetical protein |
| CRON 11. | |||||||||||||
| omr2 |
|
|
|
|
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -23 score = 5.77877 sequence = GATATGTTATAACATAACAAAAA Gene: PMI2619: predicted zinc-related TonB-dependent outer membrane transporter |
|
predicted zinc-related TonB-dependent outer membrane transporter |
| omr3 |
|
|
|
|
|
|
|
|
|
|
Gene: PMI2618: predicted zinc-related TonB-dependent outer membrane transporter |
|
predicted zinc-related TonB-dependent outer membrane transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |