Regulon of Zur in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM4241
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.7 Sequence: GAAATGTGATATTATAACATTCT Locus tag: STM1892.S Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: STM1893 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	STM1892.S	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	STM1893	znuB	high-affinity zinc ABC transporter, membrane component
Position: -52 Score: 6.6 Sequence: AGAATGTTATAATATCACATTTC Locus tag: STM1891 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	STM1891	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -35 Score: 5.8 Sequence: TTATTGTTATGTTATAACATAAT Locus tag: STM0469 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: STM0470 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	STM0469	rpmE2	50S ribosomal protein L31 paralog
	STM0470	rpmJ2	50S ribosomal protein L36 paralog
Position: -54 Score: 6.2 Sequence: GCAATGTTATAATATAACAATCA Locus tag: STM1263 Name: zinT Funciton: zinc-binding protein
	STM1263	zinT	zinc-binding protein
Position: -54 Score: 5.9 Sequence: TTATTGTTACAATATAACAATTA Locus tag: STM2610 Name: pliG Funciton: periplasmic lysozme inhibitor of g-type lysozyme
	STM2610	pliG	periplasmic lysozme inhibitor of g-type lysozyme

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD