Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yciC gene

Properties
Regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -25
Score: 5.61005
Sequence: TTATTGTTACGTTATAACATAAC
Locus tag: CKO_00923
Name: hisI2
Funciton: phosphoribosyl-AMP cyclohydrolase
Locus tag: CKO_00924
Name: hisI2
Funciton: phosphoribosyl-AMP cyclohydrolase
Locus tag: CKO_00925
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
hisI2-hisI2-yciC -25 5.6 TTATTGTTACGTTATAACATAAC CKO_00923
Serratia proteamaculans 568
Position: -69
Score: 5.82403
Sequence: GATATGTTATAACATAACAAAAT
Locus tag: Spro_2628
Name: yciA
Funciton: protein of unknown function DUF198
Locus tag: Spro_2627
Name: can2
Funciton: carbonic anhydrase
Locus tag: Spro_2626
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciA-can2-yciC -69 5.8 GATATGTTATAACATAACAAAAT Spro_2628
© 2009-2020 RegPrecise