Regulon of Zur in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y0573
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.7 Sequence: AAAGCGTAATATTATAACATTCA Locus tag: y2250 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: y2251 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	y2250	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	y2251	znuB	high-affinity zinc ABC transporter, membrane component
Position: -51 Score: 5.6 Sequence: TGAATGTTATAATATTACGCTTT Locus tag: y2249 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	y2249	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -36 Score: 5.9 Sequence: ATGATGTTACATTATAACATACT Locus tag: y1048 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog
	y1048	rpmE2	50S ribosomal protein L31 paralog
Position: 6 Score: 5.1 Sequence: TATGTGTTACATTATAACGGTTT Locus tag: y1329 Name: ECA3248 Funciton: ABC-type uncharacterized transport system, periplasmic component Locus tag: y1330 Name: ECA3247 Funciton: ABC-type uncharacterized transport system, permease component
	y1329	ECA3248	ABC-type uncharacterized transport system, periplasmic component
	y1330	ECA3247	ABC-type uncharacterized transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD