Regulon of Zur in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_0267
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.1 Sequence: ATTTTGTGATATTATAACATTTG Locus tag: EAM_2001 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: EAM_2002 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	EAM_2001	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	EAM_2002	znuB	high-affinity zinc ABC transporter, membrane component
Position: -36 Score: 6 Sequence: TTTTGGTTATATTATAACATATC Locus tag: EAM_1015 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: EAM_1014 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	EAM_1015	rpmE2	50S ribosomal protein L31 paralog
	EAM_1014	rpmJ2	50S ribosomal protein L36 paralog
Position: -52 Score: 5.9 Sequence: CAAATGTTATAATATCACAAAAT Locus tag: EAM_2000 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	EAM_2000	znuA	high-affinity zinc ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD