Regulon of Zur in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_4457
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	20
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.8 Sequence: GAGGCGTGATATTATAACATTCG Locus tag: Spro_2774 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: Spro_2775 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	Spro_2774	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	Spro_2775	znuB	high-affinity zinc ABC transporter, membrane component
Position: -51 Score: 5.7 Sequence: CGAATGTTATAATATCACGCCTC Locus tag: Spro_2773 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	Spro_2773	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -36 Score: 6.2 Sequence: TTATTGTTATAGTATAACATTAC Locus tag: Spro_1125 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: Spro_1124 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	Spro_1125	rpmE2	50S ribosomal protein L31 paralog
	Spro_1124	rpmJ2	50S ribosomal protein L36 paralog
Position: -185 Score: 5.8 Sequence: GTGATGTTATAATGTAACACTTA Locus tag: Spro_1121 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: Spro_1122 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: Spro_1123 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	Spro_1121	znuC2	putative zinc ABC transporter, ATP-binding protein
	Spro_1122	znuB2	putative zinc ABC transporter, membrane protein
	Spro_1123	znuA2	putative zinc ABC transporter, substrate-binding protein
Position: -69 Score: 5.8 Sequence: GATATGTTATAACATAACAAAAT Locus tag: Spro_2628 Name: yciA Funciton: protein of unknown function DUF198 Locus tag: Spro_2627 Name: can2 Funciton: carbonic anhydrase Locus tag: Spro_2626 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Spro_2628	yciA	protein of unknown function DUF198
	Spro_2627	can2	carbonic anhydrase
	Spro_2626	yciC	Putative zinc chaperone, COG0523 family
Position: -43 Score: 6.5 Sequence: GATATGTTATAATATAACAATTA Locus tag: Spro_1939 Name: dksA2 Funciton: DnaK suppressor protein
	Spro_1939	dksA2	DnaK suppressor protein
Position: -85 Score: 6 Sequence: TTATTGTTATGTTATAACATAAC Position: -80 Score: 5.7 Sequence: GTTATGTTATAACATAACAAAAA Locus tag: Spro_1297 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Spro_1298 Name: znuX Funciton: predicted zinc-related ABC transporter, periplasmic binding protein Locus tag: Spro_1299 Name: znuW Funciton: predicted zinc-related methyltransferase type 12 Locus tag: Spro_1300 Name: znuY Funciton: predicted zinc-related ABC transporter, permease protein Locus tag: Spro_1301 Name: null Funciton: predicted zinc-related ABC transporter, ATP-binding protein
	Spro_1297	omr1	predicted zinc-related TonB-dependent outer membrane transporter
	Spro_1298	znuX	predicted zinc-related ABC transporter, periplasmic binding protein
	Spro_1299	znuW	predicted zinc-related methyltransferase type 12
	Spro_1300	znuY	predicted zinc-related ABC transporter, permease protein
	Spro_1301		predicted zinc-related ABC transporter, ATP-binding protein
Position: -3 Score: 5.3 Sequence: TTTATGTTACTTTATAACAATAA Locus tag: Spro_3632 Name: ECA3248 Funciton: ABC-type uncharacterized transport system, periplasmic component Locus tag: Spro_3631 Name: ECA3247 Funciton: ABC-type uncharacterized transport system, permease component
	Spro_3632	ECA3248	ABC-type uncharacterized transport system, periplasmic component
	Spro_3631	ECA3247	ABC-type uncharacterized transport system, permease component
Position: -47 Score: 5.4 Sequence: GAGATGTTTTGTTATAACGTATC Locus tag: Spro_3158 Name: CKO_00947 Funciton: hypothetical protein
	Spro_3158	CKO_00947	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Serratia proteamaculans 568

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --