Regulon of Zur in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_03867
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	26
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.7 Sequence: GAAATGTGATATTATAACATTCT Locus tag: CKO_01105 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: CKO_01104 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	CKO_01105	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	CKO_01104	znuB	high-affinity zinc ABC transporter, membrane component
Position: -37 Score: 6.6 Sequence: AGAATGTTATAATATCACATTTC Locus tag: CKO_01106 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	CKO_01106	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -35 Score: 5.5 Sequence: TTATTGTTACGTTATAACATAAT Locus tag: CKO_02696 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: CKO_02695 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	CKO_02696	rpmE2	50S ribosomal protein L31 paralog
	CKO_02695	rpmJ2	50S ribosomal protein L36 paralog
Position: -91 Score: 6.8 Sequence: GTGATGTTATATTATAACATTCC Locus tag: CKO_01827 Name: zinT Funciton: zinc-binding protein
	CKO_01827	zinT	zinc-binding protein
Position: -141 Score: 6.1 Sequence: TTATTGTTATGTTATAACATTTT Locus tag: CKO_04054 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: CKO_04053 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: CKO_04052 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	CKO_04054	znuC2	putative zinc ABC transporter, ATP-binding protein
	CKO_04053	znuB2	putative zinc ABC transporter, membrane protein
	CKO_04052	znuA2	putative zinc ABC transporter, substrate-binding protein
Position: -45 Score: 5.7 Sequence: CATTTGTTATGTTATAACGTTAC Locus tag: CKO_00951 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: CKO_00950 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: CKO_00949 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	CKO_00951	znuC2	putative zinc ABC transporter, ATP-binding protein
	CKO_00950	znuB2	putative zinc ABC transporter, membrane protein
	CKO_00949	znuA2	putative zinc ABC transporter, substrate-binding protein
Position: -49 Score: 6.2 Sequence: TTAATGTTATGTTATAACGTTTC Locus tag: CKO_00932 Name: dksA2 Funciton: DnaK suppressor protein Locus tag: CKO_00933 Name: yciA Funciton: protein of unknown function DUF198 Locus tag: CKO_00934 Name: can2 Funciton: carbonic anhydrase
	CKO_00932	dksA2	DnaK suppressor protein
	CKO_00933	yciA	protein of unknown function DUF198
	CKO_00934	can2	carbonic anhydrase
Position: -45 Score: 6.3 Sequence: GATATGTTATGTTATAACATATC Locus tag: CKO_00835 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: CKO_00834 Name: znuX Funciton: predicted zinc-related ABC transporter, periplasmic binding protein Locus tag: CKO_00833 Name: znuW Funciton: predicted zinc-related methyltransferase type 12 Locus tag: CKO_00832 Name: znuY Funciton: predicted zinc-related ABC transporter, permease protein
	CKO_00835	omr1	predicted zinc-related TonB-dependent outer membrane transporter
	CKO_00834	znuX	predicted zinc-related ABC transporter, periplasmic binding protein
	CKO_00833	znuW	predicted zinc-related methyltransferase type 12
	CKO_00832	znuY	predicted zinc-related ABC transporter, permease protein
Position: -29 Score: 6.1 Sequence: TAATTGTTATGATATAACATATC Locus tag: CKO_00850 Name: ECA4254 Funciton: predicted zinc-regulated ABC transporter, ATP-binding protein Locus tag: CKO_00851 Name: ECA4255 Funciton: predicted zinc-regulated ABC transporter, periplasmic-binding protein Locus tag: CKO_00852 Name: ECA4256 Funciton: predicted zinc-regulated ABC transporter, permease protein
	CKO_00850	ECA4254	predicted zinc-regulated ABC transporter, ATP-binding protein
	CKO_00851	ECA4255	predicted zinc-regulated ABC transporter, periplasmic-binding protein
	CKO_00852	ECA4256	predicted zinc-regulated ABC transporter, permease protein
Position: -111 Score: 5.8 Sequence: GTTATGTTATTTTATAACATCCA Locus tag: CKO_00947 Name: CKO_00947 Funciton: hypothetical protein
	CKO_00947	CKO_00947	hypothetical protein
Position: -25 Score: 5.6 Sequence: TTATTGTTACGTTATAACATAAC Locus tag: CKO_00923 Name: hisI2 Funciton: phosphoribosyl-AMP cyclohydrolase Locus tag: CKO_00924 Name: hisI2 Funciton: phosphoribosyl-AMP cyclohydrolase Locus tag: CKO_00925 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	CKO_00923	hisI2	phosphoribosyl-AMP cyclohydrolase
	CKO_00924	hisI2	phosphoribosyl-AMP cyclohydrolase
	CKO_00925	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Citrobacter koseri ATCC BAA-895

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --