Regulon of Zur in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_0232
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.7 Sequence: GAAACGTTATATTATAACATTCC Locus tag: ETAE_1442 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: ETAE_1441 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	ETAE_1442	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	ETAE_1441	znuB	high-affinity zinc ABC transporter, membrane component
Position: -50 Score: 6.6 Sequence: GGAATGTTATAATATAACGTTTC Locus tag: ETAE_1443 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	ETAE_1443	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -148 Score: 5.9 Sequence: GTATTGTTATAACATAACATATG Locus tag: ETAE_1964 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	ETAE_1964	rpmJ2	50S ribosomal protein L36 paralog

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD