Regulon of Zur in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_04434
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.4 Sequence: GTGATGTGATATTATAACATTCA Locus tag: KPN_02373 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: KPN_02374 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	KPN_02373	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	KPN_02374	znuB	high-affinity zinc ABC transporter, membrane component
Position: -100 Score: 6.3 Sequence: TGAATGTTATAATATCACATCAC Locus tag: KPN_02372 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	KPN_02372	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -35 Score: 5.5 Sequence: TTATTGTTATGTTATAACGTAAT Locus tag: KPN_00435 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: KPN_00436 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	KPN_00435	rpmE2	50S ribosomal protein L31 paralog
	KPN_00436	rpmJ2	50S ribosomal protein L36 paralog
Position: -55 Score: 5.7 Sequence: GATATGTTATATCGTAACAATTT Locus tag: KPN_04244 Name: zinT Funciton: zinc-binding protein
	KPN_04244	zinT	zinc-binding protein
Position: -108 Score: 6 Sequence: TTATTGTTATGTTATAACATTAA Locus tag: KPN_03035 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: KPN_03034 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: KPN_03033 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	KPN_03035	znuC2	putative zinc ABC transporter, ATP-binding protein
	KPN_03034	znuB2	putative zinc ABC transporter, membrane protein
	KPN_03033	znuA2	putative zinc ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD