Regulon of Zur in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI2748
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 6.7 Sequence: GAAATGTTATATTATAACGTTTC Locus tag: PMI1151 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: PMI1150 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	PMI1151	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	PMI1150	znuB	high-affinity zinc ABC transporter, membrane component
Position: -50 Score: 6.7 Sequence: GAAACGTTATAATATAACATTTC Locus tag: PMI1152 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	PMI1152	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -38 Score: 6.5 Sequence: ATATTGTTATATTATAACATTAC Locus tag: PMI3379 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: PMI3380 Name: zinT Funciton: zinc-binding protein
	PMI3379	rpmE2	50S ribosomal protein L31 paralog
	PMI3380	zinT	zinc-binding protein
Position: -42 Score: 6.1 Sequence: GTGATGTTATATTATAACAAAAT Locus tag: PMI1519 Name: ECA3248 Funciton: ABC-type uncharacterized transport system, periplasmic component Locus tag: PMI1518 Name: ECA3247 Funciton: ABC-type uncharacterized transport system, permease component
	PMI1519	ECA3248	ABC-type uncharacterized transport system, periplasmic component
	PMI1518	ECA3247	ABC-type uncharacterized transport system, permease component
Position: -23 Score: 5.8 Sequence: GATATGTTATAACATAACAAAAA Locus tag: PMI2619 Name: omr2 Funciton: predicted zinc-related TonB-dependent outer membrane transporter Locus tag: PMI2618 Name: omr3 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	PMI2619	omr2	predicted zinc-related TonB-dependent outer membrane transporter
	PMI2618	omr3	predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD