Regulon of Zur in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_0250
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.2 Sequence: TGGATGTGATATTATAACATTCG Locus tag: Ent638_2427 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: Ent638_2428 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	Ent638_2427	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	Ent638_2428	znuB	high-affinity zinc ABC transporter, membrane component
Position: -52 Score: 6.1 Sequence: CGAATGTTATAATATCACATCCA Locus tag: Ent638_2426 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	Ent638_2426	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -37 Score: 5.6 Sequence: CTTTTGTTATGTTATAACAAAAC Locus tag: Ent638_0934 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: Ent638_0935 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	Ent638_0934	rpmE2	50S ribosomal protein L31 paralog
	Ent638_0935	rpmJ2	50S ribosomal protein L36 paralog
Position: -53 Score: 6.1 Sequence: GATATGTTATACTATAACATCCT Locus tag: Ent638_1993 Name: zinT Funciton: zinc-binding protein
	Ent638_1993	zinT	zinc-binding protein
Position: -140 Score: 5.9 Sequence: TTAGTGTTATGTTATAACATTAT Locus tag: Ent638_3178 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: Ent638_3177 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: Ent638_3176 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	Ent638_3178	znuC2	putative zinc ABC transporter, ATP-binding protein
	Ent638_3177	znuB2	putative zinc ABC transporter, membrane protein
	Ent638_3176	znuA2	putative zinc ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD