Regulon of Zur in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b4046
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.5 Sequence: GAAGTGTGATATTATAACATTTC Locus tag: b1858 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: b1859 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	b1858	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	b1859	znuB	high-affinity zinc ABC transporter, membrane component
Position: -52 Score: 6.5 Sequence: GAAATGTTATAATATCACACTTC Locus tag: b1857 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	b1857	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -34 Score: 5.6 Sequence: TTATGGTTATGTTATAACATAAC Locus tag: b0296 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: b4506 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	b0296	rpmE2	50S ribosomal protein L31 paralog
	b4506	rpmJ2	50S ribosomal protein L36 paralog
Position: -56 Score: 6.3 Sequence: TATATGTTACAATATAACATTAC Locus tag: b1973 Name: zinT Funciton: zinc-binding protein
	b1973	zinT	zinc-binding protein
Position: -53 Score: 6.3 Sequence: GGATTGTTATATTATAACAGTTC Locus tag: b1178 Name: pliG Funciton: periplasmic lysozme inhibitor of g-type lysozyme
	b1178	pliG	periplasmic lysozme inhibitor of g-type lysozyme

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD