Regulon of Zur in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA0632
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Enterobacteriales
Statistics of regulated genes:
- Genes	13
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 65 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.4 Sequence: TGTTTGTTATATTATAACATTAC Locus tag: ECA2485 Name: znuC Funciton: high-affinity zinc ABC transporter, ATP-binding protein Locus tag: ECA2486 Name: znuB Funciton: high-affinity zinc ABC transporter, membrane component
	ECA2485	znuC	high-affinity zinc ABC transporter, ATP-binding protein
	ECA2486	znuB	high-affinity zinc ABC transporter, membrane component
Position: -53 Score: 6.3 Sequence: GTAATGTTATAATATAACAAACA Locus tag: ECA2484 Name: znuA Funciton: high-affinity zinc ABC transporter, substrate-binding protein
	ECA2484	znuA	high-affinity zinc ABC transporter, substrate-binding protein
Position: -31 Score: 6 Sequence: GATATGTTATAACATAACAATTG Locus tag: ECA1168 Name: rpmE2 Funciton: 50S ribosomal protein L31 paralog Locus tag: ECA1167 Name: rpmJ2 Funciton: 50S ribosomal protein L36 paralog
	ECA1168	rpmE2	50S ribosomal protein L31 paralog
	ECA1167	rpmJ2	50S ribosomal protein L36 paralog
Position: -123 Score: 6.5 Sequence: GATATGTTATAATATAACAATTA Locus tag: ECA3756 Name: znuC2 Funciton: putative zinc ABC transporter, ATP-binding protein Locus tag: ECA3757 Name: znuB2 Funciton: putative zinc ABC transporter, membrane protein Locus tag: ECA3758 Name: znuA2 Funciton: putative zinc ABC transporter, substrate-binding protein
	ECA3756	znuC2	putative zinc ABC transporter, ATP-binding protein
	ECA3757	znuB2	putative zinc ABC transporter, membrane protein
	ECA3758	znuA2	putative zinc ABC transporter, substrate-binding protein
Position: -3 Score: 5.7 Sequence: ATAATGTTACATTATAACGCTTT Locus tag: ECA3248 Name: ECA3248 Funciton: ABC-type uncharacterized transport system, periplasmic component Locus tag: ECA3247 Name: ECA3247 Funciton: ABC-type uncharacterized transport system, permease component
	ECA3248	ECA3248	ABC-type uncharacterized transport system, periplasmic component
	ECA3247	ECA3247	ABC-type uncharacterized transport system, permease component
Position: -55 Score: 5.4 Sequence: AATTTGGTATGTTATAACATACC Locus tag: ECA4254 Name: ECA4254 Funciton: predicted zinc-regulated ABC transporter, ATP-binding protein Locus tag: ECA4255 Name: ECA4255 Funciton: predicted zinc-regulated ABC transporter, periplasmic-binding protein Locus tag: ECA4256 Name: ECA4256 Funciton: predicted zinc-regulated ABC transporter, permease protein
	ECA4254	ECA4254	predicted zinc-regulated ABC transporter, ATP-binding protein
	ECA4255	ECA4255	predicted zinc-regulated ABC transporter, periplasmic-binding protein
	ECA4256	ECA4256	predicted zinc-regulated ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD