Regulog TsrR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Statistics of regulated genes
Genome	Genes	Operons
Shewanella amazonensis SB2B
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella halifaxensis HAW-EB4	25	3
Shewanella loihica PV-4	14	2
Shewanella oneidensis MR-1	14	2
Shewanella pealeana ATCC 700345	25	3
Shewanella piezotolerans WP3	14	2
Shewanella putrefaciens CN-32	12	2
Shewanella sediminis HAW-EB3	25	3
Shewanella sp ANA-3	9	2
Shewanella sp MR-4	14	2
Shewanella sp MR-7	14	2
Shewanella sp W3-18-1	12	2
Shewanella woodyi ATCC 51908	25	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
tsrA	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4* Site: position = -287 score = 4.73586 sequence = CTTTTTTGCGATTCAAAAAACG Site: position = -257 score = 6.03197 sequence = TGATTTTTATATCTAAAAAGAT Gene: Shal_0567: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Site: position = -263 score = 5.52002 sequence = ATCCTTTTAGATGTCAAAAGGT Gene: Shal_0551: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella loihica PV-4 Site: position = -320 score = 5.37216 sequence = TATTTTTCATAACTCAAAAAGC Site: position = -290 score = 6.20201 sequence = CTTTTTTGAGATCTAAAAATGC Gene: Shew_0348: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella oneidensis MR-1 Site: position = -250 score = 6.87076 sequence = GTTTTTTTAGATCTAAAAAAAC Gene: SO0479: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	2 Shewanella pealeana ATCC 700345* Site: position = -259 score = 6.03197 sequence = TGATTTTTATATCTAAAAAGAT Site: position = -289 score = 5.355 sequence = CTTTTTTGCGATTTAAAAAACG Gene: Spea_0503: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Site: position = -264 score = 6.31096 sequence = GTCTTTTTAGATATCAAAAAAT Site: position = -262 score = 4.79101 sequence = CTTTTTAGATATCAAAAAATGC Gene: Spea_0479: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella piezotolerans WP3 Site: position = -366 score = 6.4489 sequence = CTTTTTTTAGATCTAAAAATAA Gene: swp_4657: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella putrefaciens CN-32 Site: position = -253 score = 5.77197 sequence = TTTTTTTTATAACTAAAACAGG Site: position = -232 score = 5.98059 sequence = GCTTTTTTACTTCTAAAAAACA Gene: Sputcn32_3364: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	2 Shewanella sediminis HAW-EB3* Site: position = -254 score = 6.12805 sequence = ATCCTTTTAGATCTAAAAAACA Gene: Ssed_0482: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Site: position = -256 score = 5.26264 sequence = CGATTTTTATTTCTAAAATGAT Site: position = -132 score = 4.9448 sequence = TGTTTTTTATATGGAAAATAGA Gene: Ssed_0493: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella sp ANA-3 Site: position = -253 score = 6.44135 sequence = CTCTTTTTAGATCTAAAAAGCC Gene: Shewana3_0489: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella sp MR-4 Site: position = -253 score = 6.4162 sequence = GTCTTTTTATATCTCAAAAAAC Gene: Shewmr4_0488: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella sp MR-7 Site: position = -253 score = 6.44938 sequence = GTCTTTTTAGATCTCAAAAACC Gene: Shewmr7_3542: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	* Shewanella sp W3-18-1 Site: position = -253 score = 5.77197 sequence = TTTTTTTTATAACTAAAACAGG Site: position = -232 score = 5.98059 sequence = GCTTTTTTACTTCTAAAAAACA Gene: Sputw3181_0577: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	2 Shewanella woodyi ATCC 51908* Site: position = -258 score = 5.82181 sequence = CAGTTTTTAGATCTAAAAAATC Site: position = -134 score = 4.91542 sequence = TGTTTTTTATATGGAAAATACT Gene: Swoo_4456: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Site: position = -265 score = 5.73365 sequence = AACCTTTTAGATATCAAAAAAC Gene: Swoo_4477: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
tsrB	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0568: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Gene: Shal_0552: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella loihica PV-4 Gene: Shew_0349: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella oneidensis MR-1 Gene: SO0480: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	2 Shewanella pealeana ATCC 700345 Gene: Spea_0480: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Gene: Spea_0504: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella piezotolerans WP3 Gene: swp_4656: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella putrefaciens CN-32 Gene: Sputcn32_3363: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0483: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Gene: Ssed_0494: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella sp ANA-3 Gene: Shewana3_0490: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella sp MR-4 Gene: Shewmr4_0489: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella sp MR-7 Gene: Shewmr7_3541: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Shewanella sp W3-18-1 Gene: Sputw3181_0578: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4476: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Gene: Swoo_4455: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
tsrC	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0569: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Gene: Shal_0553: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella loihica PV-4 Gene: Shew_0350: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella oneidensis MR-1 Gene: SO0481: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	2 Shewanella pealeana ATCC 700345 Gene: Spea_0481: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Gene: Spea_0505: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella piezotolerans WP3 Gene: swp_4655: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella putrefaciens CN-32 Gene: Sputcn32_3362: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0484: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Gene: Ssed_0495: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella sp ANA-3 Gene: Shewana3_0491: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella sp MR-4 Gene: Shewmr4_0490: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella sp MR-7 Gene: Shewmr7_3540: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Shewanella sp W3-18-1 Gene: Sputw3181_0579: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4454: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Gene: Swoo_4475: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
tsrD	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0570: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Gene: Shal_0554: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella loihica PV-4 Gene: Shew_0351: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella oneidensis MR-1 Gene: SO0482: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	2 Shewanella pealeana ATCC 700345 Gene: Spea_0482: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Gene: Spea_0506: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella piezotolerans WP3 Gene: swp_4654: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella putrefaciens CN-32 Gene: Sputcn32_3361: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0496: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Gene: Ssed_0485: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella sp ANA-3 Gene: Shewana3_0492: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella sp MR-4 Gene: Shewmr4_0491: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella sp MR-7 Gene: Shewmr7_3539: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Shewanella sp W3-18-1 Gene: Sputw3181_0580: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4474: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Gene: Swoo_4453: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
tsrE	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0571: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Gene: Shal_0555: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella loihica PV-4 Gene: Shew_0352: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella oneidensis MR-1 Gene: SO0483: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	2 Shewanella pealeana ATCC 700345 Gene: Spea_0483: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Gene: Spea_0507: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella piezotolerans WP3 Gene: swp_4653: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella putrefaciens CN-32	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0486: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Gene: Ssed_0497: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella sp ANA-3 Gene: Shewana3_0493: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella sp MR-4 Gene: Shewmr4_0492: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella sp MR-7 Gene: Shewmr7_3538: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Shewanella sp W3-18-1	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4452: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Gene: Swoo_4473: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
tsrF	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0556: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Gene: Shal_0572: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella loihica PV-4 Gene: Shew_0353: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella oneidensis MR-1 Gene: SO0484: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	2 Shewanella pealeana ATCC 700345 Gene: Spea_0484: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Gene: Spea_0508: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella piezotolerans WP3 Gene: swp_4652: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella putrefaciens CN-32	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0487: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Gene: Ssed_0498: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella sp ANA-3 Gene: Shewana3_0494: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella sp MR-4 Gene: Shewmr4_0493: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella sp MR-7 Gene: Shewmr7_3537: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Shewanella sp W3-18-1	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4451: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Gene: Swoo_4472: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
tsrG	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0557: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Gene: Shal_0573: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella loihica PV-4 Gene: Shew_0354: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella oneidensis MR-1 Gene: SO0485: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	2 Shewanella pealeana ATCC 700345 Gene: Spea_0485: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Gene: Spea_0509: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella piezotolerans WP3 Gene: swp_4651: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella putrefaciens CN-32 Gene: Sputcn32_3360: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0488: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Gene: Ssed_0499: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella sp ANA-3	Shewanella sp MR-4 Gene: Shewmr4_0494: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella sp MR-7 Gene: Shewmr7_3536: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Shewanella sp W3-18-1 Gene: Sputw3181_0581: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4471: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Gene: Swoo_4450: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
tsrH	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0558: Predicted thiosulfate respiratory reductase maturation protein TsrH Gene: Shal_0574: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella loihica PV-4 Gene: Shew_0355: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella oneidensis MR-1 Gene: SO0486: Predicted thiosulfate respiratory reductase maturation protein TsrH	2 Shewanella pealeana ATCC 700345 Gene: Spea_0486: Predicted thiosulfate respiratory reductase maturation protein TsrH Gene: Spea_0510: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella piezotolerans WP3 Gene: swp_4649: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella putrefaciens CN-32 Gene: Sputcn32_3359: Predicted thiosulfate respiratory reductase maturation protein TsrH	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0500: Predicted thiosulfate respiratory reductase maturation protein TsrH Gene: Ssed_0489: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella sp ANA-3 Gene: Shewana3_0496: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella sp MR-4 Gene: Shewmr4_0495: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella sp MR-7 Gene: Shewmr7_3535: Predicted thiosulfate respiratory reductase maturation protein TsrH	Shewanella sp W3-18-1 Gene: Sputw3181_0582: Predicted thiosulfate respiratory reductase maturation protein TsrH	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4449: Predicted thiosulfate respiratory reductase maturation protein TsrH Gene: Swoo_4470: Predicted thiosulfate respiratory reductase maturation protein TsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
tsrI	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0575: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Gene: Shal_0559: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella loihica PV-4 Gene: Shew_0356: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella oneidensis MR-1 Gene: SO0487: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	2 Shewanella pealeana ATCC 700345 Gene: Spea_0487: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Gene: Spea_0511: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella piezotolerans WP3 Gene: swp_4648: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella putrefaciens CN-32 Gene: Sputcn32_3358: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0501: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Gene: Ssed_0490: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella sp ANA-3 Gene: Shewana3_0497: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella sp MR-4 Gene: Shewmr4_0496: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella sp MR-7 Gene: Shewmr7_3534: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Shewanella sp W3-18-1 Gene: Sputw3181_0583: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4469: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Gene: Swoo_4448: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
tsrY	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0560: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Gene: Shal_0576: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella loihica PV-4 Gene: Shew_0357: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella oneidensis MR-1 Gene: SO0488: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	2 Shewanella pealeana ATCC 700345 Gene: Spea_0488: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Gene: Spea_0512: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella piezotolerans WP3 Gene: swp_4647: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella putrefaciens CN-32 Gene: Sputcn32_3357: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0502: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Gene: Ssed_0491: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella sp ANA-3 Gene: Shewana3_0498: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella sp MR-4 Gene: Shewmr4_0497: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella sp MR-7 Gene: Shewmr7_3533: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Shewanella sp W3-18-1 Gene: Sputw3181_0584: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4468: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Gene: Swoo_4447: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
tsrR	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	2 Shewanella halifaxensis HAW-EB4 Gene: Shal_0561: Predicted transcriptional regulator, winged HTH domain Gene: Shal_0577: Predicted transcriptional regulator, winged HTH domain	Shewanella loihica PV-4 Gene: Shew_0358: Predicted transcriptional regulator, winged HTH domain	Shewanella oneidensis MR-1 Gene: SO0490: Predicted transcriptional regulator, winged HTH domain	2 Shewanella pealeana ATCC 700345 Gene: Spea_0489: Predicted transcriptional regulator, winged HTH domain Gene: Spea_0513: Predicted transcriptional regulator, winged HTH domain	Shewanella piezotolerans WP3 Gene: swp_4644: Predicted transcriptional regulator, winged HTH domain	Shewanella putrefaciens CN-32 Gene: Sputcn32_3356: Predicted transcriptional regulator, winged HTH domain	2 Shewanella sediminis HAW-EB3 Gene: Ssed_0503: Predicted transcriptional regulator, winged HTH domain Gene: Ssed_0492: Predicted transcriptional regulator, winged HTH domain	Shewanella sp ANA-3 Gene: Shewana3_0499: Predicted transcriptional regulator, winged HTH domain	Shewanella sp MR-4 Gene: Shewmr4_0498: Predicted transcriptional regulator, winged HTH domain	Shewanella sp MR-7 Gene: Shewmr7_3532: Predicted transcriptional regulator, winged HTH domain	Shewanella sp W3-18-1 Gene: Sputw3181_0585: Predicted transcriptional regulator, winged HTH domain	2 Shewanella woodyi ATCC 51908 Gene: Swoo_4467: Predicted transcriptional regulator, winged HTH domain Gene: Swoo_4446: Predicted transcriptional regulator, winged HTH domain	Predicted transcriptional regulator, winged HTH domain

CRON 2.
ccmF-2	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella halifaxensis HAW-EB4 Site: position = -314 score = 5.52002 sequence = ACCTTTTGACATCTAAAAGGAT Gene: Shal_0550: Cytochrome c heme lyase subunit CcmF	* Shewanella loihica PV-4 Site: position = -169 score = 6.20201 sequence = GCATTTTTAGATCTCAAAAAAG Site: position = -139 score = 5.37216 sequence = GCTTTTTGAGTTATGAAAAATA Gene: Shew_0347: Cytochrome c heme lyase subunit CcmF	* Shewanella oneidensis MR-1 Site: position = -281 score = 6.87076 sequence = GTTTTTTTAGATCTAAAAAAAC Gene: SO0478: Cytochrome c heme lyase subunit CcmF	* Shewanella pealeana ATCC 700345 Site: position = -316 score = 4.79101 sequence = GCATTTTTTGATATCTAAAAAG Site: position = -314 score = 6.31096 sequence = ATTTTTTGATATCTAAAAAGAC Gene: Spea_0478: Cytochrome c heme lyase subunit CcmF	* Shewanella piezotolerans WP3 Site: position = -258 score = 6.4489 sequence = TTATTTTTAGATCTAAAAAAAG Gene: swp_4658: Cytochrome c heme lyase subunit CcmF	* Shewanella putrefaciens CN-32 Site: position = -334 score = 5.98059 sequence = TGTTTTTTAGAAGTAAAAAAGC Site: position = -313 score = 5.77197 sequence = CCTGTTTTAGTTATAAAAAAAA Gene: Sputcn32_3365: Cytochrome c heme lyase subunit CcmF	* Shewanella sediminis HAW-EB3 Site: position = -314 score = 6.12805 sequence = TGTTTTTTAGATCTAAAAGGAT Gene: Ssed_0481: Cytochrome c heme lyase subunit CcmF	* Shewanella sp ANA-3 Site: position = -284 score = 6.44135 sequence = GGCTTTTTAGATCTAAAAAGAG Gene: Shewana3_0488: Cytochrome c heme lyase subunit CcmF	* Shewanella sp MR-4 Site: position = -315 score = 6.4162 sequence = GTTTTTTGAGATATAAAAAGAC Gene: Shewmr4_0487: Cytochrome c heme lyase subunit CcmF	* Shewanella sp MR-7 Site: position = -316 score = 6.44938 sequence = GGTTTTTGAGATCTAAAAAGAC Gene: Shewmr7_3543: Cytochrome c heme lyase subunit CcmF	* Shewanella sp W3-18-1 Site: position = -334 score = 5.98059 sequence = TGTTTTTTAGAAGTAAAAAAGC Site: position = -313 score = 5.77197 sequence = CCTGTTTTAGTTATAAAAAAAA Gene: Sputw3181_0576: Cytochrome c heme lyase subunit CcmF	* Shewanella woodyi ATCC 51908 Site: position = -320 score = 5.73365 sequence = GTTTTTTGATATCTAAAAGGTT Gene: Swoo_4478: Cytochrome c heme lyase subunit CcmF	Cytochrome c heme lyase subunit CcmF
ccmL	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4 Gene: Shal_0549: Cytochrome c heme lyase subunit CcmL	Shewanella loihica PV-4 Gene: Shew_0346: Cytochrome c heme lyase subunit CcmL	Shewanella oneidensis MR-1 Gene: SO0477: Cytochrome c heme lyase subunit CcmL	Shewanella pealeana ATCC 700345 Gene: Spea_0477: Cytochrome c heme lyase subunit CcmL	Shewanella piezotolerans WP3 Gene: swp_4659: Cytochrome c heme lyase subunit CcmL	Shewanella putrefaciens CN-32 Gene: Sputcn32_3366: Cytochrome c heme lyase subunit CcmL	Shewanella sediminis HAW-EB3 Gene: Ssed_0480: Cytochrome c heme lyase subunit CcmL	Shewanella sp ANA-3 Gene: Shewana3_0487: Cytochrome c heme lyase subunit CcmL	Shewanella sp MR-4 Gene: Shewmr4_0486: Cytochrome c heme lyase subunit CcmL	Shewanella sp MR-7 Gene: Shewmr7_3544: Cytochrome c heme lyase subunit CcmL	Shewanella sp W3-18-1 Gene: Sputw3181_0575: Cytochrome c heme lyase subunit CcmL	Shewanella woodyi ATCC 51908 Gene: Swoo_4479: Cytochrome c heme lyase subunit CcmL	Cytochrome c heme lyase subunit CcmL
ccmH	Shewanella amazonensis SB2B	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella halifaxensis HAW-EB4 Gene: Shal_0548: Thioredoxin	Shewanella loihica PV-4 Gene: Shew_0345: Thioredoxin	Shewanella oneidensis MR-1 Gene: SO0476: Thioredoxin	Shewanella pealeana ATCC 700345 Gene: Spea_0476: Thioredoxin	Shewanella piezotolerans WP3 Gene: swp_4660: Thioredoxin	Shewanella putrefaciens CN-32 Gene: Sputcn32_3367: Thioredoxin	Shewanella sediminis HAW-EB3 Gene: Ssed_0479: Thioredoxin	Shewanella sp ANA-3 Gene: Shewana3_0486: Thioredoxin	Shewanella sp MR-4 Gene: Shewmr4_0485: Thioredoxin	Shewanella sp MR-7 Gene: Shewmr7_3545: Thioredoxin	Shewanella sp W3-18-1 Gene: Sputw3181_0574: Thioredoxin	Shewanella woodyi ATCC 51908 Gene: Swoo_4480: Thioredoxin	Thioredoxin

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TsrR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --