Regulon of TsrR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_0585
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -253 Score: 5.8 Sequence: TTTTTTTTATAACTAAAACAGG Position: -232 Score: 6 Sequence: GCTTTTTTACTTCTAAAAAACA Locus tag: Sputw3181_0577 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Sputw3181_0578 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Sputw3181_0579 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Sputw3181_0580 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Sputw3181_0581 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Sputw3181_0582 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Sputw3181_0583 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Sputw3181_0584 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Sputw3181_0585 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Sputw3181_0577	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Sputw3181_0578	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Sputw3181_0579	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Sputw3181_0580	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Sputw3181_0581	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Sputw3181_0582	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Sputw3181_0583	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Sputw3181_0584	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Sputw3181_0585	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -334 Score: 6 Sequence: TGTTTTTTAGAAGTAAAAAAGC Position: -313 Score: 5.8 Sequence: CCTGTTTTAGTTATAAAAAAAA Locus tag: Sputw3181_0576 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Sputw3181_0575 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Sputw3181_0574 Name: ccmH Funciton: Thioredoxin
	Sputw3181_0576	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Sputw3181_0575	ccmL	Cytochrome c heme lyase subunit CcmL
	Sputw3181_0574	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD