Regulon of TsrR in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:	swp_4644
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -366 Score: 6.4 Sequence: CTTTTTTTAGATCTAAAAATAA Locus tag: swp_4657 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: swp_4656 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: swp_4655 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: swp_4654 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: swp_4653 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: swp_4652 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: swp_4651 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: swp_4649 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: swp_4648 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: swp_4647 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: swp_4644 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	swp_4657	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	swp_4656	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	swp_4655	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	swp_4654	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	swp_4653	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	swp_4652	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	swp_4651	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	swp_4649	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	swp_4648	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	swp_4647	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	swp_4644	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -258 Score: 6.4 Sequence: TTATTTTTAGATCTAAAAAAAG Locus tag: swp_4658 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: swp_4659 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: swp_4660 Name: ccmH Funciton: Thioredoxin
	swp_4658	ccmF-2	Cytochrome c heme lyase subunit CcmF
	swp_4659	ccmL	Cytochrome c heme lyase subunit CcmL
	swp_4660	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD