Regulon of TsrR in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_3532
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -316 Score: 6.4 Sequence: GGTTTTTGAGATCTAAAAAGAC Locus tag: Shewmr7_3543 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Shewmr7_3544 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Shewmr7_3545 Name: ccmH Funciton: Thioredoxin
	Shewmr7_3543	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Shewmr7_3544	ccmL	Cytochrome c heme lyase subunit CcmL
	Shewmr7_3545	ccmH	Thioredoxin
Position: -253 Score: 6.4 Sequence: GTCTTTTTAGATCTCAAAAACC Locus tag: Shewmr7_3542 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shewmr7_3541 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shewmr7_3540 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shewmr7_3539 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shewmr7_3538 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shewmr7_3537 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Shewmr7_3536 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Shewmr7_3535 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Shewmr7_3534 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Shewmr7_3533 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Shewmr7_3532 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Shewmr7_3542	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shewmr7_3541	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shewmr7_3540	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shewmr7_3539	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shewmr7_3538	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shewmr7_3537	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shewmr7_3536	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Shewmr7_3535	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Shewmr7_3534	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Shewmr7_3533	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Shewmr7_3532	tsrR	Predicted transcriptional regulator, winged HTH domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD