Regulon of TsrR in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_3356
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -253 Score: 5.8 Sequence: TTTTTTTTATAACTAAAACAGG Position: -232 Score: 6 Sequence: GCTTTTTTACTTCTAAAAAACA Locus tag: Sputcn32_3364 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Sputcn32_3363 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Sputcn32_3362 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Sputcn32_3361 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Sputcn32_3360 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Sputcn32_3359 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Sputcn32_3358 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Sputcn32_3357 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Sputcn32_3356 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Sputcn32_3364	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Sputcn32_3363	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Sputcn32_3362	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Sputcn32_3361	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Sputcn32_3360	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Sputcn32_3359	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Sputcn32_3358	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Sputcn32_3357	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Sputcn32_3356	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -334 Score: 6 Sequence: TGTTTTTTAGAAGTAAAAAAGC Position: -313 Score: 5.8 Sequence: CCTGTTTTAGTTATAAAAAAAA Locus tag: Sputcn32_3365 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Sputcn32_3366 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Sputcn32_3367 Name: ccmH Funciton: Thioredoxin
	Sputcn32_3365	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Sputcn32_3366	ccmL	Cytochrome c heme lyase subunit CcmL
	Sputcn32_3367	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD