Regulon of TsrR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO0490
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -250 Score: 6.9 Sequence: GTTTTTTTAGATCTAAAAAAAC Locus tag: SO0479 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: SO0480 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: SO0481 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: SO0482 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: SO0483 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: SO0484 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: SO0485 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: SO0486 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: SO0487 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: SO0488 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: SO0490 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	SO0479	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	SO0480	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	SO0481	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	SO0482	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	SO0483	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	SO0484	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	SO0485	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	SO0486	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	SO0487	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	SO0488	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	SO0490	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -281 Score: 6.9 Sequence: GTTTTTTTAGATCTAAAAAAAC Locus tag: SO0478 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: SO0477 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: SO0476 Name: ccmH Funciton: Thioredoxin
	SO0478	ccmF-2	Cytochrome c heme lyase subunit CcmF
	SO0477	ccmL	Cytochrome c heme lyase subunit CcmL
	SO0476	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD