Regulon of TsrR in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_0577, Shal_0561
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -263 Score: 5.5 Sequence: ATCCTTTTAGATGTCAAAAGGT Locus tag: Shal_0551 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shal_0552 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shal_0553 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shal_0554 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shal_0555 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shal_0556 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Shal_0557 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Shal_0558 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Shal_0559 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Shal_0560 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Shal_0561 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Shal_0551	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shal_0552	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shal_0553	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shal_0554	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shal_0555	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shal_0556	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shal_0557	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Shal_0558	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Shal_0559	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Shal_0560	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Shal_0561	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -287 Score: 4.7 Sequence: CTTTTTTGCGATTCAAAAAACG Position: -257 Score: 6 Sequence: TGATTTTTATATCTAAAAAGAT Locus tag: Shal_0567 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shal_0568 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shal_0569 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shal_0570 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shal_0571 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shal_0572 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Shal_0573 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Shal_0574 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Shal_0575 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Shal_0576 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Shal_0577 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Shal_0567	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shal_0568	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shal_0569	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shal_0570	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shal_0571	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shal_0572	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shal_0573	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Shal_0574	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Shal_0575	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Shal_0576	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Shal_0577	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -314 Score: 5.5 Sequence: ACCTTTTGACATCTAAAAGGAT Locus tag: Shal_0550 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Shal_0549 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Shal_0548 Name: ccmH Funciton: Thioredoxin
	Shal_0550	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Shal_0549	ccmL	Cytochrome c heme lyase subunit CcmL
	Shal_0548	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of TsrR in Shewanella halifaxensis HAW-EB4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --