Regulon of TsrR in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_0503, Ssed_0492
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -256 Score: 5.3 Sequence: CGATTTTTATTTCTAAAATGAT Position: -132 Score: 4.9 Sequence: TGTTTTTTATATGGAAAATAGA Locus tag: Ssed_0493 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Ssed_0494 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Ssed_0495 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Ssed_0496 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Ssed_0497 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Ssed_0498 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Ssed_0499 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Ssed_0500 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Ssed_0501 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Ssed_0502 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Ssed_0503 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Ssed_0493	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Ssed_0494	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Ssed_0495	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Ssed_0496	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Ssed_0497	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Ssed_0498	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Ssed_0499	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Ssed_0500	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Ssed_0501	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Ssed_0502	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Ssed_0503	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -254 Score: 6.1 Sequence: ATCCTTTTAGATCTAAAAAACA Locus tag: Ssed_0482 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Ssed_0483 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Ssed_0484 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Ssed_0485 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Ssed_0486 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Ssed_0487 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Ssed_0488 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Ssed_0489 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Ssed_0490 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Ssed_0491 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Ssed_0492 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Ssed_0482	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Ssed_0483	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Ssed_0484	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Ssed_0485	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Ssed_0486	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Ssed_0487	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Ssed_0488	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Ssed_0489	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Ssed_0490	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Ssed_0491	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Ssed_0492	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -314 Score: 6.1 Sequence: TGTTTTTTAGATCTAAAAGGAT Locus tag: Ssed_0481 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Ssed_0480 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Ssed_0479 Name: ccmH Funciton: Thioredoxin
	Ssed_0481	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Ssed_0480	ccmL	Cytochrome c heme lyase subunit CcmL
	Ssed_0479	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of TsrR in Shewanella sediminis HAW-EB3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --