Regulon of TsrR in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_0489, Spea_0513
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -289 Score: 5.4 Sequence: CTTTTTTGCGATTTAAAAAACG Position: -259 Score: 6 Sequence: TGATTTTTATATCTAAAAAGAT Locus tag: Spea_0503 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Spea_0504 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Spea_0505 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Spea_0506 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Spea_0507 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Spea_0508 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Spea_0509 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Spea_0510 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Spea_0511 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Spea_0512 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Spea_0513 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Spea_0503	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Spea_0504	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Spea_0505	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Spea_0506	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Spea_0507	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Spea_0508	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Spea_0509	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Spea_0510	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Spea_0511	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Spea_0512	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Spea_0513	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -264 Score: 6.3 Sequence: GTCTTTTTAGATATCAAAAAAT Position: -262 Score: 4.8 Sequence: CTTTTTAGATATCAAAAAATGC Locus tag: Spea_0479 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Spea_0480 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Spea_0481 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Spea_0482 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Spea_0483 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Spea_0484 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Spea_0485 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Spea_0486 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Spea_0487 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Spea_0488 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Spea_0489 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Spea_0479	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Spea_0480	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Spea_0481	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Spea_0482	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Spea_0483	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Spea_0484	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Spea_0485	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Spea_0486	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Spea_0487	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Spea_0488	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Spea_0489	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -316 Score: 4.8 Sequence: GCATTTTTTGATATCTAAAAAG Position: -314 Score: 6.3 Sequence: ATTTTTTGATATCTAAAAAGAC Locus tag: Spea_0478 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Spea_0477 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Spea_0476 Name: ccmH Funciton: Thioredoxin
	Spea_0478	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Spea_0477	ccmL	Cytochrome c heme lyase subunit CcmL
	Spea_0476	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of TsrR in Shewanella pealeana ATCC 700345

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --