Regulon of TsrR in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_4446, Swoo_4467
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -265 Score: 5.7 Sequence: AACCTTTTAGATATCAAAAAAC Locus tag: Swoo_4477 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Swoo_4476 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Swoo_4475 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Swoo_4474 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Swoo_4473 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Swoo_4472 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Swoo_4471 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Swoo_4470 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Swoo_4469 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Swoo_4468 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Swoo_4467 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Swoo_4477	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Swoo_4476	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Swoo_4475	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Swoo_4474	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Swoo_4473	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Swoo_4472	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Swoo_4471	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Swoo_4470	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Swoo_4469	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Swoo_4468	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Swoo_4467	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -258 Score: 5.8 Sequence: CAGTTTTTAGATCTAAAAAATC Position: -134 Score: 4.9 Sequence: TGTTTTTTATATGGAAAATACT Locus tag: Swoo_4456 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Swoo_4455 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Swoo_4454 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Swoo_4453 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Swoo_4452 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Swoo_4451 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Swoo_4450 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Swoo_4449 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Swoo_4448 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Swoo_4447 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Swoo_4446 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Swoo_4456	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Swoo_4455	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Swoo_4454	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Swoo_4453	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Swoo_4452	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Swoo_4451	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Swoo_4450	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Swoo_4449	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Swoo_4448	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Swoo_4447	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Swoo_4446	tsrR	Predicted transcriptional regulator, winged HTH domain
Position: -320 Score: 5.7 Sequence: GTTTTTTGATATCTAAAAGGTT Locus tag: Swoo_4478 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Swoo_4479 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Swoo_4480 Name: ccmH Funciton: Thioredoxin
	Swoo_4478	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Swoo_4479	ccmL	Cytochrome c heme lyase subunit CcmL
	Swoo_4480	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of TsrR in Shewanella woodyi ATCC 51908

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --