Regulon of TsrR in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0498
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -315 Score: 6.4 Sequence: GTTTTTTGAGATATAAAAAGAC Locus tag: Shewmr4_0487 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Shewmr4_0486 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Shewmr4_0485 Name: ccmH Funciton: Thioredoxin
	Shewmr4_0487	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Shewmr4_0486	ccmL	Cytochrome c heme lyase subunit CcmL
	Shewmr4_0485	ccmH	Thioredoxin
Position: -253 Score: 6.4 Sequence: GTCTTTTTATATCTCAAAAAAC Locus tag: Shewmr4_0488 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shewmr4_0489 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shewmr4_0490 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shewmr4_0491 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shewmr4_0492 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shewmr4_0493 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Shewmr4_0494 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Shewmr4_0495 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Shewmr4_0496 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Shewmr4_0497 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Shewmr4_0498 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Shewmr4_0488	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shewmr4_0489	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shewmr4_0490	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shewmr4_0491	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shewmr4_0492	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shewmr4_0493	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shewmr4_0494	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Shewmr4_0495	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Shewmr4_0496	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Shewmr4_0497	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Shewmr4_0498	tsrR	Predicted transcriptional regulator, winged HTH domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD