Regulon of TsrR in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_0358
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 6.2 Sequence: GCATTTTTAGATCTCAAAAAAG Position: -139 Score: 5.4 Sequence: GCTTTTTGAGTTATGAAAAATA Locus tag: Shew_0347 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Shew_0346 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Shew_0345 Name: ccmH Funciton: Thioredoxin
	Shew_0347	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Shew_0346	ccmL	Cytochrome c heme lyase subunit CcmL
	Shew_0345	ccmH	Thioredoxin
Position: -320 Score: 5.4 Sequence: TATTTTTCATAACTCAAAAAGC Position: -290 Score: 6.2 Sequence: CTTTTTTGAGATCTAAAAATGC Locus tag: Shew_0348 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shew_0349 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shew_0350 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shew_0351 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shew_0352 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shew_0353 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF Locus tag: Shew_0354 Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG Locus tag: Shew_0355 Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH Locus tag: Shew_0356 Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase) Locus tag: Shew_0357 Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ Locus tag: Shew_0358 Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain
	Shew_0348	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shew_0349	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shew_0350	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shew_0351	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shew_0352	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shew_0353	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shew_0354	tsrG	Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
	Shew_0355	tsrH	Predicted thiosulfate respiratory reductase maturation protein TsrH
	Shew_0356	tsrI	Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
	Shew_0357	tsrY	Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
	Shew_0358	tsrR	Predicted transcriptional regulator, winged HTH domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD