Regulon of TsrR in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_0499
Regulator family:	[Other]
Regulation mode:
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	TsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 40 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - [Other]
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -253 Score: 6.4 Sequence: CTCTTTTTAGATCTAAAAAGCC Locus tag: Shewana3_0489 Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA Locus tag: Shewana3_0490 Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB Locus tag: Shewana3_0491 Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase Locus tag: Shewana3_0492 Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase Locus tag: Shewana3_0493 Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE Locus tag: Shewana3_0494 Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
	Shewana3_0489	tsrA	Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
	Shewana3_0490	tsrB	Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
	Shewana3_0491	tsrC	Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
	Shewana3_0492	tsrD	Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
	Shewana3_0493	tsrE	Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
	Shewana3_0494	tsrF	Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Position: -284 Score: 6.4 Sequence: GGCTTTTTAGATCTAAAAAGAG Locus tag: Shewana3_0488 Name: ccmF-2 Funciton: Cytochrome c heme lyase subunit CcmF Locus tag: Shewana3_0487 Name: ccmL Funciton: Cytochrome c heme lyase subunit CcmL Locus tag: Shewana3_0486 Name: ccmH Funciton: Thioredoxin
	Shewana3_0488	ccmF-2	Cytochrome c heme lyase subunit CcmF
	Shewana3_0487	ccmL	Cytochrome c heme lyase subunit CcmL
	Shewana3_0486	ccmH	Thioredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD