Regulog NsrR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	4	3
Shewanella putrefaciens CN-32	3	2
Shewanella sp W3-18-1	3	2
Shewanella sp ANA-3	7	5
Shewanella sp MR-4	5	4
Shewanella sp MR-7	5	4
Shewanella baltica OS155	5	4
Shewanella denitrificans OS217	1	1
Shewanella frigidimarina NCIMB 400	6	4
Shewanella amazonensis SB2B	4	3
Shewanella loihica PV-4	3	2
Shewanella pealeana ATCC 700345	5	3
Shewanella halifaxensis HAW-EB4	2	1
Shewanella piezotolerans WP3	5	3
Shewanella sediminis HAW-EB3	6	4
Shewanella woodyi ATCC 51908	5	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
nnrS2	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_3603: NnrS protein involved in response to NO	Shewanella sp W3-18-1 Gene: Sputw3181_3742: NnrS protein involved in response to NO	* Shewanella sp ANA-3 Site: position = -46 score = 4.52546 sequence = AAGTGCAATTATTATGAAGCT Gene: Shewana3_2362: NnrS protein involved in response to NO	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	* Shewanella denitrificans OS217 Site: position = -110 score = 4.37171 sequence = ACAatCATtaTAaATaCcTGT Gene: Sden_2837: NnrS protein involved in response to NO	* Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 5.56222 sequence = AGATTTATATATTATGCATGT Gene: Sfri_3037: NnrS protein involved in response to NO	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0504: NnrS protein involved in response to NO	* Shewanella pealeana ATCC 700345 Site: position = -35 score = 4.75461 sequence = AGCTGTATTTTAAATGCGTGT Gene: Spea_1227: NnrS protein involved in response to NO	Shewanella halifaxensis HAW-EB4 Gene: Shal_1261: NnrS protein involved in response to NO	* Shewanella piezotolerans WP3 Site: position = -39 score = 4.22593 sequence = AggTaCATtaAAaATaCcTGT Gene: swp_3404: NnrS protein involved in response to NO	Shewanella sediminis HAW-EB3 Gene: Ssed_0687: NnrS protein involved in response to NO	Shewanella woodyi ATCC 51908	NnrS protein involved in response to NO
nrfA	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_3604: Nitrite reductase, cytochrome c(552)	Shewanella sp W3-18-1 Gene: Sputw3181_3743: Nitrite reductase, cytochrome c(552)	Shewanella sp ANA-3 Gene: Shewana3_2363: Nitrite reductase, cytochrome c(552)	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3036: Nitrite reductase, cytochrome c(552)	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0505: Nitrite reductase, cytochrome c(552)	Shewanella pealeana ATCC 700345 Gene: Spea_1228: Nitrite reductase, cytochrome c(552)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1262: Nitrite reductase, cytochrome c(552)	Shewanella piezotolerans WP3 Gene: swp_3403: Nitrite reductase, cytochrome c(552)	Shewanella sediminis HAW-EB3 Gene: Ssed_0688: Nitrite reductase, cytochrome c(552)	Shewanella woodyi ATCC 51908	Nitrite reductase, cytochrome c(552)

CRON 2.
Ssed_4366	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4 Gene: Shal_1091: hydroxylamine oxidoreductase	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -169 score = 5.0032 sequence = ACATGCAAAATCAATACAGGT Gene: Ssed_4366: hydroxylamine oxidoreductase	* Shewanella woodyi ATCC 51908 Site: position = -139 score = 5.04606 sequence = ACATGCGAAAAATATACAGGT Gene: Swoo_4755: hydroxylamine oxidoreductase	hydroxylamine oxidoreductase
Ssed_4367	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4 Gene: Shal_1092: NapC/NirT cytochrome c domain protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4367: NapC/NirT cytochrome c domain protein	Shewanella woodyi ATCC 51908 Gene: Swoo_4756: NapC/NirT cytochrome c domain protein	NapC/NirT cytochrome c domain protein

CRON 3.
hmp	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -33 score = 5.56015 sequence = ACATTCATAAATAAAGCATGT Gene: Shewana3_3174: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	* Shewanella sp MR-4 Site: position = -67 score = 4.35195 sequence = TGATCCAAATCAAATGAATCT Site: position = -33 score = 4.68107 sequence = ACATTCATAAATAAGGCGTGT Gene: Shewmr4_2996: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	* Shewanella sp MR-7 Site: position = -67 score = 4.35195 sequence = TGATCCAAATCAAATGAATCT Site: position = -33 score = 5.76688 sequence = ACATTCATAAATAATGCATGT Gene: Shewmr7_3077: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	* Shewanella baltica OS155 Site: position = -33 score = 5.30822 sequence = ACATTCATAATATTTACACGT Gene: Sbal_1014: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -125 score = 4.82051 sequence = ACCTTTATATAATTTATATGT Gene: Sfri_3699: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_4285: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908 Gene: Swoo_0685: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)

CRON 4.
nnrS	* Shewanella oneidensis MR-1 Site: position = -59 score = 5.36731 sequence = ACATTCATTTAATTTGCAGCT Gene: SO_2805: NnrS protein involved in response to NO	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -58 score = 5.36731 sequence = ACATTCATTTTATTTGCAGCT Gene: Shewana3_2587: NnrS protein involved in response to NO	* Shewanella sp MR-4 Site: position = -58 score = 5.36731 sequence = ACATTCATTTTATTTGCAGCT Gene: Shewmr4_2425: NnrS protein involved in response to NO	* Shewanella sp MR-7 Site: position = -58 score = 5.36731 sequence = ACATTCATTTTATTTGCAGCT Gene: Shewmr7_2495: NnrS protein involved in response to NO	* Shewanella baltica OS155 Site: position = -63 score = 5.26116 sequence = ACATTCATTTTAATTGCAGCT Gene: Sbal_1680: NnrS protein involved in response to NO	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -59 score = 5.39056 sequence = ACATGCATATTTTAAGCACCT Gene: Sama_1288: NnrS protein involved in response to NO	* Shewanella loihica PV-4 Site: position = -64 score = 5.24358 sequence = ACATGCATATAAATTACACCT Gene: Shew_2322: NnrS protein involved in response to NO	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -13 score = 4.48067 sequence = ACTTGCATCTTAAATGCACCT Gene: Ssed_2876: NnrS protein involved in response to NO	Shewanella woodyi ATCC 51908	NnrS protein involved in response to NO

CRON 5.
dnrN	* Shewanella oneidensis MR-1 Site: position = -126 score = 5.63847 sequence = AGCTGCAAATAATATGCATGT Gene: SO_4302: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella putrefaciens CN-32 Site: position = -49 score = 5.47346 sequence = AGCTGCAAATAATATGAATGT Gene: Sputcn32_3576: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp W3-18-1 Site: position = -49 score = 5.47346 sequence = AGCTGCAAATAATATGAATGT Gene: Sputw3181_3715: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp ANA-3 Site: position = -49 score = 5.62575 sequence = AGCTGCAAATATTATGCATGT Gene: Shewana3_0397: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp MR-4 Site: position = -49 score = 5.62575 sequence = AGCTGCAAATATTATGCATGT Gene: Shewmr4_0398: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp MR-7 Site: position = -49 score = 5.62575 sequence = AGCTGCAAATATTATGCATGT Gene: Shewmr7_3627: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella baltica OS155 Site: position = -48 score = 5.68929 sequence = AGATGCAAATAATATGAATGT Gene: Sbal_3989: Nitric oxide-dependent regulator DnrN or NorA	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -26 score = 5.24766 sequence = AGATGCACATAAAATACATGT Gene: Sfri_0450: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella amazonensis SB2B Site: position = -34 score = 4.60171 sequence = ACATGCATACAGATTGCAGCT Gene: Sama_3236: Nitric oxide-dependent regulator DnrN or NorA	Shewanella loihica PV-4 Gene: Shew_0328: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella pealeana ATCC 700345 Site: position = -60 score = 5.8543 sequence = AGATGCAAATAATATGCATGT Gene: Spea_0383: Nitric oxide-dependent regulator DnrN or NorA	Shewanella halifaxensis HAW-EB4 Gene: Shal_3908: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella piezotolerans WP3 Site: position = -46 score = 5.10978 sequence = AGATGCAAATAATATACTTGT Gene: swp_0412: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sediminis HAW-EB3 Site: position = -32 score = 4.82744 sequence = AGATATAAATAATTTGCAGCT Gene: Ssed_4124: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella woodyi ATCC 51908 Site: position = -33 score = 4.86029 sequence = ACATGCAAATACAAAGCAGCT Gene: Swoo_0492: Nitric oxide-dependent regulator DnrN or NorA	Nitric oxide-dependent regulator DnrN or NorA

CRON 6.
hcp	* Shewanella oneidensis MR-1 Site: position = -42 score = 5.23703 sequence = ACATGTAAAAATAAAGCATGA Gene: SO_1363: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella putrefaciens CN-32 Site: position = -42 score = 5.4973 sequence = ACATGCATAAATAAAGCATGA Gene: Sputcn32_1174: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella sp W3-18-1 Site: position = -42 score = 5.4973 sequence = ACATGCATAAATAAAGCATGA Gene: Sputw3181_2990: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella sp ANA-3 Site: position = -42 score = 5.42434 sequence = ACATGCAAAAATAAAGCATGA Gene: Shewana3_3011: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella sp MR-4 Site: position = -42 score = 5.42434 sequence = ACATGCAAAAATAAAGCATGA Gene: Shewmr4_2832: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella sp MR-7 Site: position = -42 score = 5.42434 sequence = ACATGCAAAAATAAAGCATGA Gene: Shewmr7_2914: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella baltica OS155 Site: position = -42 score = 5.23703 sequence = ACATGTAAAAATAAAGCATGA Gene: Sbal_1216: Hydroxylamine reductase (EC 1.7.-.-)	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -43 score = 5.01171 sequence = ACATGTAAAACTTATACATGA Gene: Sfri_3609: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella amazonensis SB2B Site: position = -40 score = 5.4973 sequence = ACATGCATAAATAAAGCATGA Site: position = -83 score = 4.48464 sequence = TGCTGCTTTTTAAATGCAGCA Gene: Sama_0895: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella loihica PV-4 Site: position = -41 score = 5.13253 sequence = ACGTGCAAATAAAAAGCATGA Gene: Shew_1069: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella pealeana ATCC 700345 Site: position = -43 score = 5.57535 sequence = ACATGTAAATAATATGCATGA Gene: Spea_1055: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella halifaxensis HAW-EB4 Site: position = -13 score = 5.57535 sequence = ACATGTAAATAATATGCATGA Gene: Shal_1103: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella piezotolerans WP3 Site: position = 41 score = 5.8543 sequence = AGATGCAAATTATATGCATGT Gene: swp_3762: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella sediminis HAW-EB3 Site: position = -42 score = 5.44979 sequence = ACATGCAAATAAAAAGCATGA Gene: Ssed_1165: Hydroxylamine reductase (EC 1.7.-.-)	* Shewanella woodyi ATCC 51908 Site: position = -42 score = 5.44979 sequence = ACATGCAAATAAAAAGCATGA Gene: Swoo_1260: Hydroxylamine reductase (EC 1.7.-.-)	Hydroxylamine reductase (EC 1.7.-.-)
hcr	Shewanella oneidensis MR-1 Gene: SO_1364: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella putrefaciens CN-32 Gene: Sputcn32_1175: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella sp W3-18-1 Gene: Sputw3181_2989: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella sp ANA-3 Gene: Shewana3_3010: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella sp MR-4 Gene: Shewmr4_2831: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella sp MR-7 Gene: Shewmr7_2913: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella baltica OS155 Gene: Sbal_1217: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_3608: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella amazonensis SB2B Gene: Sama_0896: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella loihica PV-4 Gene: Shew_1070: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella pealeana ATCC 700345 Gene: Spea_1056: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_1104: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella piezotolerans WP3 Gene: swp_3761: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella sediminis HAW-EB3 Gene: Ssed_1166: NADH oxidoreductase hcr (EC 1.-.-.-)	Shewanella woodyi ATCC 51908 Gene: Swoo_1261: NADH oxidoreductase hcr (EC 1.-.-.-)	NADH oxidoreductase hcr (EC 1.-.-.-)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NsrR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --