Regulon of NsrR in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_4221
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 4.8 Sequence: AGCTGTATTTTAAATGCGTGT Locus tag: Spea_1227 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Spea_1228 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
	Spea_1227	nnrS2	NnrS protein involved in response to NO
	Spea_1228	nrfA	Nitrite reductase, cytochrome c(552)
Position: -43 Score: 5.6 Sequence: ACATGTAAATAATATGCATGA Locus tag: Spea_1055 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Spea_1056 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Spea_1055	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Spea_1056	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)
Position: -60 Score: 5.9 Sequence: AGATGCAAATAATATGCATGT Locus tag: Spea_0383 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Spea_0383	dnrN	Nitric oxide-dependent regulator DnrN or NorA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD