Regulon of NsrR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO0045
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.4 Sequence: ACATTCATTTAATTTGCAGCT Locus tag: SO_2805 Name: nnrS Funciton: NnrS protein involved in response to NO
	SO_2805	nnrS	NnrS protein involved in response to NO
Position: -126 Score: 5.6 Sequence: AGCTGCAAATAATATGCATGT Locus tag: SO_4302 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	SO_4302	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -42 Score: 5.2 Sequence: ACATGTAAAAATAAAGCATGA Locus tag: SO_1363 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: SO_1364 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	SO_1363	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	SO_1364	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD