Regulon of NsrR in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_0047
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 4.5 Sequence: AAGTGCAATTATTATGAAGCT Locus tag: Shewana3_2362 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Shewana3_2363 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
	Shewana3_2362	nnrS2	NnrS protein involved in response to NO
	Shewana3_2363	nrfA	Nitrite reductase, cytochrome c(552)
Position: -33 Score: 5.6 Sequence: ACATTCATAAATAAAGCATGT Locus tag: Shewana3_3174 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Shewana3_3174	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -58 Score: 5.4 Sequence: ACATTCATTTTATTTGCAGCT Locus tag: Shewana3_2587 Name: nnrS Funciton: NnrS protein involved in response to NO
	Shewana3_2587	nnrS	NnrS protein involved in response to NO
Position: -49 Score: 5.6 Sequence: AGCTGCAAATATTATGCATGT Locus tag: Shewana3_0397 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Shewana3_0397	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -42 Score: 5.4 Sequence: ACATGCAAAAATAAAGCATGA Locus tag: Shewana3_3011 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Shewana3_3010 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Shewana3_3011	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Shewana3_3010	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD