Regulon of NsrR in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_0056
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.4 Sequence: ACATGCATATTTTAAGCACCT Locus tag: Sama_1288 Name: nnrS Funciton: NnrS protein involved in response to NO
	Sama_1288	nnrS	NnrS protein involved in response to NO
Position: -34 Score: 4.6 Sequence: ACATGCATACAGATTGCAGCT Locus tag: Sama_3236 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sama_3236	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -83 Score: 4.5 Sequence: TGCTGCTTTTTAAATGCAGCA Position: -40 Score: 5.5 Sequence: ACATGCATAAATAAAGCATGA Locus tag: Sama_0895 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Sama_0896 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Sama_0895	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Sama_0896	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD