Regulon of NsrR in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_0039
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 5.6 Sequence: ACATGTAAATAATATGCATGA Locus tag: Shal_1103 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Shal_1104 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Shal_1103	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Shal_1104	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD