Regulon of NsrR in Shewanella halifaxensis HAW-EB4
| Regulator type: | Transcription factor |
| TF locus tag: | Shal_0039 |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Regulog: | NsrR - Shewanellaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -13
Score: 5.6 Sequence: ACATGTAAATAATATGCATGA
Locus tag: Shal_1103
Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
Locus tag: Shal_1104
Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-) |
|||
|
hcp
|
Hydroxylamine reductase (EC 1.7.-.-)
|
||
|
hcr
|
NADH oxidoreductase hcr (EC 1.-.-.-)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |