Regulon of NsrR in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0041
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 5.4 Sequence: ACATTCATTTTATTTGCAGCT Locus tag: Shewmr4_2425 Name: nnrS Funciton: NnrS protein involved in response to NO
	Shewmr4_2425	nnrS	NnrS protein involved in response to NO
Position: -67 Score: 4.4 Sequence: TGATCCAAATCAAATGAATCT Position: -33 Score: 4.7 Sequence: ACATTCATAAATAAGGCGTGT Locus tag: Shewmr4_2996 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Shewmr4_2996	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -42 Score: 5.4 Sequence: ACATGCAAAAATAAAGCATGA Locus tag: Shewmr4_2832 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Shewmr4_2831 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Shewmr4_2832	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Shewmr4_2831	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)
Position: -49 Score: 5.6 Sequence: AGCTGCAAATATTATGCATGT Locus tag: Shewmr4_0398 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Shewmr4_0398	dnrN	Nitric oxide-dependent regulator DnrN or NorA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD