Orthologous regulated operons containing nnrS2 gene

Properties
Regulog:	NsrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -110 Score: 4.37171 Sequence: ACAatCATtaTAaATaCcTGT Locus tag: Sden_2837 Name: nnrS2 Funciton: NnrS protein involved in response to NO
nnrS2	-110	4.4	ACAatCATtaTAaATaCcTGT	Sden_2837
Shewanella frigidimarina NCIMB 400
Position: -64 Score: 5.56222 Sequence: AGATTTATATATTATGCATGT Locus tag: Sfri_3037 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Sfri_3036 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA	-64	5.6	AGATTTATATATTATGCATGT	Sfri_3037
Shewanella pealeana ATCC 700345
Position: -35 Score: 4.75461 Sequence: AGCTGTATTTTAAATGCGTGT Locus tag: Spea_1227 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Spea_1228 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA	-35	4.8	AGCTGTATTTTAAATGCGTGT	Spea_1227
Shewanella piezotolerans WP3
Position: -39 Score: 4.22593 Sequence: AggTaCATtaAAaATaCcTGT Locus tag: swp_3404 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: swp_3403 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA	-39	4.2	AggTaCATtaAAaATaCcTGT	swp_3404
Shewanella sp ANA-3
Position: -46 Score: 4.52546 Sequence: AAGTGCAATTATTATGAAGCT Locus tag: Shewana3_2362 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Shewana3_2363 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA	-46	4.5	AAGTGCAATTATTATGAAGCT	Shewana3_2362

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --