Regulon of NsrR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_4042
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.5 Sequence: AGCTGCAAATAATATGAATGT Locus tag: Sputw3181_3715 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sputw3181_3715	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -42 Score: 5.5 Sequence: ACATGCATAAATAAAGCATGA Locus tag: Sputw3181_2990 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Sputw3181_2989 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Sputw3181_2990	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Sputw3181_2989	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD