Regulon of NsrR in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_4336
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.3 Sequence: ACATTCATAATATTTACACGT Locus tag: Sbal_1014 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Sbal_1014	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -63 Score: 5.3 Sequence: ACATTCATTTTAATTGCAGCT Locus tag: Sbal_1680 Name: nnrS Funciton: NnrS protein involved in response to NO
	Sbal_1680	nnrS	NnrS protein involved in response to NO
Position: -42 Score: 5.2 Sequence: ACATGTAAAAATAAAGCATGA Locus tag: Sbal_1216 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Sbal_1217 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Sbal_1216	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Sbal_1217	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)
Position: -48 Score: 5.7 Sequence: AGATGCAAATAATATGAATGT Locus tag: Sbal_3989 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sbal_3989	dnrN	Nitric oxide-dependent regulator DnrN or NorA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD