Regulon of NsrR in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_4881
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5 Sequence: ACATGCGAAAAATATACAGGT Locus tag: Swoo_4755 Name: Ssed_4366 Funciton: hydroxylamine oxidoreductase Locus tag: Swoo_4756 Name: Ssed_4367 Funciton: NapC/NirT cytochrome c domain protein
	Swoo_4755	Ssed_4366	hydroxylamine oxidoreductase
	Swoo_4756	Ssed_4367	NapC/NirT cytochrome c domain protein
Position: -42 Score: 5.4 Sequence: ACATGCAAATAAAAAGCATGA Locus tag: Swoo_1260 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Swoo_1261 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Swoo_1260	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Swoo_1261	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)
Position: -33 Score: 4.9 Sequence: ACATGCAAATACAAAGCAGCT Locus tag: Swoo_0492 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Swoo_0492	dnrN	Nitric oxide-dependent regulator DnrN or NorA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD