Regulon of NsrR in Shewanella frigidimarina NCIMB 400

Properties
Regulator type:	Transcription factor
TF locus tag:	Sfri_4024
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.6 Sequence: AGATTTATATATTATGCATGT Locus tag: Sfri_3037 Name: nnrS2 Funciton: NnrS protein involved in response to NO Locus tag: Sfri_3036 Name: nrfA Funciton: Nitrite reductase, cytochrome c(552)
	Sfri_3037	nnrS2	NnrS protein involved in response to NO
	Sfri_3036	nrfA	Nitrite reductase, cytochrome c(552)
Position: -125 Score: 4.8 Sequence: ACCTTTATATAATTTATATGT Locus tag: Sfri_3699 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Sfri_3699	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -26 Score: 5.2 Sequence: AGATGCACATAAAATACATGT Locus tag: Sfri_0450 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sfri_0450	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -43 Score: 5 Sequence: ACATGTAAAACTTATACATGA Locus tag: Sfri_3609 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Sfri_3608 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Sfri_3609	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Sfri_3608	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD